Log In Sign up
The largest database of trusted experimental protocols

7d dslr camera

Manufactured by Canon
Visit Supplier
Sourced in Japan

The Canon 7D is a DSLR camera with a 18.0 megapixel APS-C CMOS sensor, 19-point autofocus system, and 8 frames per second continuous shooting. It is capable of recording 1080p Full HD video at 30 frames per second.

Automatically generated - may contain errors

Lab products found in correlation

S8ap0 stereomicroscope, by Leica (1 mentions)

Spelling variants of this product

DSLR camera (16 citations) Canon 7D camera (8 citations)

2 protocols using 7d dslr camera

1

Cloning and Characterizing Zebrafish sorcs3 and ccdc147

Check if the same lab product or an alternative is used in the 5 most similar protocols
We cloned fragments of sorcs3 and ccdc147 from zebrafish cDNAs by RT-PCR and subcloned them into pGEMT-easy vectors for antisense probe synthesis. Primer pairs used are as follows: sorcs3 (forward: GTC​GCC​AAT​GCA​AGT​GAA​TTA​CGC; reverse: TTT​CCA​GAC​CAG​TAC​ACG​ACT​GCG​T) and ccdc147 (forward: GAC​GAC​AGT​ACG​TTG​GAA​ACC​ATG​G; reverse: CGG​TGG​CTT​TAG​TAA​GGT​TTT​CCC​G). Whole-mount in-situ hybridization (WISH) was performed as described using digoxigenin (DIG)-labeled antisense RNA probe (Thisse and Thisse, 2008 (link)). Stained embryos were mounted in glycerol, observed under a Leica S8AP0 stereomicroscope (Leica Microsystems, Wetzlar, Germany), and photographed using a Canon 7D DSLR camera (Canon, Tokyo, Japan).
Lin M.J., Lee C.M., Hsu W.L., Chen B.C, & Lee S.J. (2022). Macrophages Break Interneuromast Cell Quiescence by Intervening in the Inhibition of Schwann Cells in the Zebrafish Lateral Line. Frontiers in Cell and Developmental Biology, 10, 907863.
+ Open protocol
+ Expand
2

Zebrafish sorcs3 and ccdc147 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA fragments of sorcs3 and ccdc147 was cloned from zebrafish cDNAs by RT-PCR and subcloned into pGEMT-easy vectors for antisense probe synthesis. Primer pairs used are as following: sorcs3 (forward: GTCGCCAATGCAAGTGAATTACGC; reverse: TTTCCAGACCAGTACACGACTGCGT) and ccdc147 (forward: GACGACAGTACGTTGGAAACCATGG; reverse: CGGTGGCTTTAGTAAGGTTTTCCCG). Whole-mount in situ hybridization (WISH) was performed as described using digoxigenin (DIG)-labeled antisense RNA probe [58] .
Stained embryos were mounted in glycerol, observed under a Leica S8AP0 stereomicroscope (Leica Microsystems, Wetzlar, Germany) and photographed using a Canon 7D DSLR camera (Canon, Tokyo, Japan).
Lin M., Lee C., Hsu W., Chen B., & Lee S. (2021). Macrophages break interneuromast cell quiescence by intervening the inhibition of Schwann cells in zebrafish lateral line.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!