Human neuroblastoma SY-SH5Y cells (ATCC, USA) were grown in Dulbecco's modified Eagle's medium, supplemented with the nutrient mixture F-12, L-glutamine (Gibco, USA), 10% fetal calf serum (PAA Laboratories GE, Austria), and 50 mg/mL of gentamicin (Biolot, Russia) under 5% CO2 at 37 °C. Cell death was estimated using the CytoTox-96 assay (Promega, USA) based on measurements of lactate dehydrogenase (LDH) activity in the culture medium.
To vary the GAPDH level in brain cells, plasmids bearing the entire gapdh gene, pLOC-GAPDH (GAPDH knock-in), and clone TRCN0000041460, shRNA to GAPDH (GAPDH knock-down), mature antisence: CTGAGTATGTCGTGGAGTCTA were purchased from Termofisher Scientific (USA). Packaging (Δ8.91) and envelope (pVSV-G) plasmids were purchased from Invitrogen, (USA). The HEK-293T host cells were transfected using polyethyleneimine (Sigma, USA) mixed with all three plasmids.
Aβ42, Aβ16, Aβ42Q15A, Aβ16Q15A, and biotinylated Aβ42 were purchased from GeneCust (Switzerland). GAPDH isolated from rabbit muscle was kindly provided by Dr. Muronetz (Moscow State University, Moscow, Russia).
To vary the GAPDH level in brain cells, plasmids bearing the entire gapdh gene, pLOC-GAPDH (GAPDH knock-in), and clone TRCN0000041460, shRNA to GAPDH (GAPDH knock-down), mature antisence: CTGAGTATGTCGTGGAGTCTA were purchased from Termofisher Scientific (USA). Packaging (Δ8.91) and envelope (pVSV-G) plasmids were purchased from Invitrogen, (USA). The HEK-293T host cells were transfected using polyethyleneimine (Sigma, USA) mixed with all three plasmids.
Aβ42, Aβ16, Aβ42Q15A, Aβ16Q15A, and biotinylated Aβ42 were purchased from GeneCust (Switzerland). GAPDH isolated from rabbit muscle was kindly provided by Dr. Muronetz (Moscow State University, Moscow, Russia).