Dnase

Remnants from nasopharyngeal swabs (in UTM matrix) of 166 SARS-CoV2 positive subjects and 14 SARS-CoV-2 negative subjects were collected at the diagnostic laboratory of Ospedale Di Venere in Bari, from May to December 2020 (Table 1 and Supplementary Data 1). Ethical approval was not required for this study, as nasopharyngeal swab remnants were from subjects that remained unidentified and data generated concern exclusively viral sequences. 560 µL of UTM matrix were used to purify viral RNA using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, German) according to the manufacturer’s instructions, without the addition of poly-A RNA carrier. The eluted RNA was treated with DNase (Zymo Research Corporation, Irvine, CA, USA) and successively concentrated with RNA Clean & Concentrator Kits (Zymo Research Corporation, Irvine, CA, USA), to the final volume of 15 µL, according to the manufacturer’s instructions. RNA samples were quantitatively and qualitatively evaluated by NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA) and 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) using the RNA 6000 Pico kit (Agilent Technologies), respectively. RNA Integrity Number (RIN) and DV200 value (the percentage of fragments >200 nucleotides), were calculated by Agilent Instrument Software. RNAs were stored at −80 °C until use.

Triplicate colonies were grown overnight in LB. Cultures were then diluted by 200-fold into 5 mL M9 glucose medium and grown for 1 h. Cells were then induced with 1 μM aTc and grown for an additional 2 h. Cultures were then diluted 900-fold in M9 glucose containing 1 μM aTc and grown to OD₆₀₀ of 0.1, followed by RNA extraction using 2 mL culture (Zymo Research Quick-RNA kit). All the RNA samples were then treated with DNAse (Zymo Research) and reverse transcribed to cDNA with RevertAid First Strand cDNA Synthesis Kit (Thermo). The cDNA samples were then subjected to qPCR using the PowerTrack SYBR Green Master Mix (Thermo) and a Quantstudio 3 instrument (Applied Biosystems). The constitutive gene dnaK was used as an internal control, and fold change for each gene was calculated using the 2^−ΔΔCT method^{86 (link)}.

RNA was prepared from tentacles of adult Nematostella using published methods (Stefanik et al., 2013 (link)). Briefly, 50 mg of tentacle tissue were homogenized and RNA was extracted using TRIzol. RNA was isolated and DNase treated (Zymo Research), then used for cDNA library synthesis (NEB E6560). Full-length sequence for a Nematostella calcium channel beta subunit was obtained with a RACE strategy using specific primers (GATTACGCCAAGCTTTATGCGTCCAATCGTACTTGTCGGC and GATTACGCCAAGCTTGCCGACAAGTACGATTGGACGCATA) on the amplified tentacle-tissue library. The final sequence was confirmed using primers corresponding to the end of the derived sequence (CAGAGCCAGGCCTGAGCGAG and GCCCCGTTAAAAGTCGAGAG) to amplify a full-length cDNA from tentacle mRNA, which was sequenced to confirm identity. nCa_v subunits: cacna1a, cacna2d1, cacnb2, and nNompC-GFP were synthesized by Genscript (Piscataway, NJ). Sequence alignments were carried out using Clustal Omega.

Total RNA was isolated with TRI Reagent®, followed by precipitation with isopropyl alcohol. DNA contamination was removed treating with DNase (Zymo Research) and RNA was concentrated using RNA Clean and Concentrator™ -5 columns (Zymo Research) following the manufacturer’s instructions. Ribosomal RNA depletion was performed with RiboMinus ™ Yeast/Bacteria Transcriptome Isolation Kit at 1 μg/μl of RNA concentration. Next-generation sequencing (NGS) libraries were prepared using Illumina TruSeq Stranded mRNA preparation kit as per the supplier’s instructions with dual indexed Illumina adapters. Paired-end (2 × 75 bp) sequencing multiplexing barcodes were added to the pooled libraries using the Illumina NextSeq 500 platform by the Unidad Universitaria de Secuenciación Masiva y Bioinformática (UUSMB)–UNAM (http://www.uusmb.unam.mx/).

Real-time PCR was used to measure the influence of garlic and ginger oil on the expression of critical Salmonella genes. Salmonella strains were grown to the mid-log phase in the presence or absence of SIC of garlic or ginger in TSB at 37 °C. The Quick-RNA Fungal/Bacterial Miniprep Kit (Zymo Research) was used to extract RNA, which was treated with DNase (Zymo Research) and subjected to reverse transcription using the iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer’s protocol. Primers (Table 1) were designed from published GenBank Salmonella sequences using Primer 3 software (National Center for Biotechnology Information) and purchased from Integrated DNA Technologies. 16S was used as an internal control for normalization, and quantification was determined by the delta-delta cycle threshold (ΔΔCt) method.