Dataassist software

Manufactured by Thermo Fisher Scientific

Sourced in United States

DataAssist software is a data analysis tool designed for use with qPCR and RT-qPCR experiments. The software provides tools for data processing, analysis, and visualization to support researchers in their work.

Automatically generated - may contain errors

Lab products found in correlation

91 protocols using dataassist software

Kinome Array Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kinome array analyses were performed as previously described [31 (link)]. Total RNA from cultured cells was extracted using the miRNeasy® Mini Kit (Qiagen, 217004). 2.4 μg DNase-treated total RNA was reverse transcribed to cDNA by using the SuperScript Vilo cDNA Synthesis Kit (Life Technologies, 4453650) as described by the Early-Access TaqMan® OpenArray® Pathway Panels User Guide. cDNA was applied to the TaqMan® Kinome panel (Life Technologies, 4467775). Data was collected with a quality score cut-off of 300 and differential expression determined by Data Assist software (Life Technologies). 828 specific assays specific to kinase and kinase-related genes are identified including 10 endogenous control genes in quadruplicate. Kinome arrays were performed in triplicates.

Posch C., Moslehi H., Sanlorenzo M., Green G., Vujic I., Panzer-Grümayer R., Rappersberger K, & Ortiz-Urda S. (2016). Pharmacological inhibitors of c-KIT block mutant c-KIT mediated migration of melanocytes and melanoma cells in vitro and in vivo. Oncotarget, 7(29), 45916-45925.

+ Open protocol

+ Expand

MicroRNA Profiling of Stored Platelets

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fold changes in microRNA levels were analyzed with DataAssist software (Life Technologies) for relative qPCR quantification, and the data presented as recommended by Van Peer et al. [40 (link)]. A difference was considered significant when the two-sided p value remained <0.05 after correction for 132 comparisons (4 treatments × 11 microRNAs × 3 time points).
Data from the three anti-apoptotic mRNAs, Dicer and RISC activity assays, platelet activation and aggregation tests, platelet volume and platelet count in PCs, were compared across five groups at each time point (day 1, 4, or 7 of storage) by non-parametric analysis of variance (ANOVA), followed by a Kruskal–Wallis test with correction for multiple comparisons.
The existence of a linear correlation between the relative change in the percentage of activated platelets and the microRNA fold change was tested by a general linear model using SAS 9.3 software (Software Intelligence Corporation, Spring Valley, CA).

Osman A., Hitzler W.E., Meyer C.U., Landry P., Corduan A., Laffont B., Boilard E., Hellstern P., Vamvakas E.C, & Provost P. (2014). Effects of pathogen reduction systems on platelet microRNAs, mRNAs, activation, and function. Platelets, 26(2), 154-163.

+ Open protocol

+ Expand

Transcriptional profiling of IPF fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured normal and IPF (both from slow and rapid progressing patients) fibroblasts as well as whole-lung samples using RNeasy kits (Qiagen). Isolated RNA was reverse transcribed into cDNA using SYBR Green PCR Master Mix (Applied Biosystems) and 5 ng of cDNA was used for transcript quantification via RT-PCR using a ViiA 7 (Applied Biosystems). Oligonucleotides primers were designed and validated by Integral DNA Technologies. MAP3K19 primers were obtained from Axikin: sense primer: 5′AATGGCACCCACAGTGACATGCTT3′; antisense primer: 5′CCCTCGGTGTGCTCCGATCTAAAA3′. The amplification efficiencies were determined for target genes and normalized to GAPDH. Delta Ct was used for comparative analysis. Commercially available primer and probe sets for both human collagen 3 and fibronectin was obtained from Applied Biosciences (Thermo Fisher). Fold change and gene expression were analyzed with Data Assist software (Life Technologies).

Jones I.C., Espindola M.S., Narayanan R., Coelho A.L., Habiel D.M., Boehme S.A., Ly T.W., Bacon K.B, & Hogaboam C.M. (2019). Targeting MAP3K19 prevents human lung myofibroblast activation both in vitro and in a humanized SCID model of idiopathic pulmonary fibrosis. Scientific Reports, 9, 19796.

+ Open protocol

+ Expand

Gene Expression Analysis in Rabbit NP Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from rabbit NP cells using the RNeasy Mini Kit (Qiagen Inc, Valencia, CA) with DNase digestion according to the manufacturer's instructions. RNA from each sample was reverse‐transcribed into complementary deoxyribonucleic acid (cDNA) with random primers using High‐Capacity cDNA Reverse Transcription Kit (Life Technologies, Carlsbad, CA). Gene expression was detected using Taqman assays specific for rabbit genes (Table 2). Amplification reactions were performed using TaqMan® Gene Expression Master Mix (Life Technologies) and 7300 Real‐Time PCR System (Life Technologies). The results were calculated in reference to internal control, Eukaryotic 18 S rRNA, using 2^−ΔCt method on Data Assist Software (Life Technologies).

Basatvat S., Bach F.C., Barcellona M.N., Binch A.L., Buckley C.T., Bueno B., Chahine N.O., Chee A., Creemers L.B., Dudli S., Fearing B., Ferguson S.J., Gansau J., Gantenbein B., Gawri R., Glaeser J.D., Grad S., Guerrero J., Haglund L., Hernandez P.A., Hoyland J.A., Huang C., Iatridis J.C., Illien‐Junger S., Jing L., Kraus P., Laagland L.T., Lang G., Leung V., Li Z., Lufkin T., van Maanen J.C., McDonnell E.E., Panebianco C.J., Presciutti S.M., Rao S., Richardson S.M., Romereim S., Schmitz T.C., Schol J., Setton L., Sheyn D., Snuggs J.W., Sun Y., Tan X., Tryfonidou M.A., Vo N., Wang D., Williams B., Williams R., Yoon S.T, & Le Maitre C.L. (2023). Harmonization and standardization of nucleus pulposus cell extraction and culture methods. JOR Spine, 6(1), e1238.

+ Open protocol

+ Expand

Normalization and Analysis of miRNA Array Data

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Raw PCR Ct values were first determined using ViiA 7 RUO software (Life Technologies) with the same parameter settings across all samples (threshold set at 0.15 with automatic baseline). Data corresponding to failed QC as determined by ViiA 7 RUO software were excluded from the analysis. In addition, miRNAs with a PCR Ct value >35 were considered as undetectable. DataAssist® software (Life Technologies) was then used to analyze miRNA array data. Different array data from cytosol and mitochondria fractions were normalized separately. The Global Mean Normalization method (Mestdagh et al., 2009 (link)) was applied to normalize the pooled dataset of both Naïve and TBI. The Ct values presented in this report, including the Supplemental data, are normalized data. The miRNA expression levels between treatments (TBI vs Naïve) or mitochondria versus cytosol fractions from naïve rat brain samples were expressed as fold changes using the following equation: fold change=2^ ^{−(Ct_TBI − Ct_Naive)}, or fold change=2^ ^{−(Ct_Mito − Ct_Cyto)}, and were evaluated using an unpaired Student t-test. Benjamini-Hochberg or permutation tests were used to control False Discovery Rate (FDR), and all significant data points (p<0.05) had a FDR< 5%. The data from the TaqMan® single-tube miRNA RT-qPCR assays were compared using unpaired student t-tests with a p<0.05 considered as statistically significant.

Wang W.X., Visavadiya N.P., Pandya J.D., Nelson P.T., Sullivan P.G, & Springer J.E. (2015). Mitochondria-associated microRNAs in rat hippocampus following traumatic brain injury. Experimental neurology, 265, 84-93.

+ Open protocol

+ Expand

Quantifying Prostate Cancer miRNA Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiRNAs relative quantities (RQ) were obtained importing raw TLDA data files in DataAssist software (Life Technologies Inc.) using a value of 35 as threshold for maximum allowable Ct and global normalization for target quantification. RQ values were then log2 transformed and imported in BRB ArrayTools (http://linus.nci.nih.gov/BRB-ArrayTools.html) where Anova or differential expression analyses were performed, as described [15 (link)]. Correlation parameters between miRNA expression and clinicopathological variables were derived using Mann-Whitney U test, Friedman test or chi-square test for continuous or discrete variable, respectively, using GraphPad Prism (GraphPad Software, Inc., La Jolla, CA) or MedCalc (Mariakerke, Belgium) statistical package. Receiver operating characteristics (ROC) curves method was used to test the accuracy of miRNAs to correctly discriminate between benign disease, PIN or prostate cancer, and to identify patients who had PSA failure (PSA> 0.2 ng/ml for at least two consecutive times) during follow-up, as described [15 (link)]. dChip software was used for unsupervised hierarchical clustering. In vitro experiments were performed at least three times and data are expressed as the mean±SD unless otherwise specified. A p value <0.05 was considered as statistically significant.

Forno I., Ferrero S., Russo M.V., Gazzano G., Giangiobbe S., Montanari E., Del Nero A., Rocco B., Albo G., Languino L.R., Altieri D.C., Vaira V, & Bosari S. (2015). Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. PLoS ONE, 10(6), e0130060.

+ Open protocol

+ Expand

miRNA Expression Profiling in Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from four lines with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) as previously described (19 (link),20 (link)). Total RNA (5 μg) was employed for hybridization on miRNA micro-array chips containing 667 probes with the TaqMan^® Array Human MicroRNA A + B Cards Set v2.0 (Life Technologies, Carlsbad, CA, USA) on a 7900 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Processed slides were scanned with a PerkinElmer ScanArray XL5K scanner. Experimental data were analyzed by DataAssist™ software (Life Technologies) using RNU44 and RNU48 as endogenous controls. Ct values were provided from all miRNAs represented on the cards and fold changes in expression were calculated using the delta Ct (ΔΔCt) method. Expression levels of MammU6 on the array card were defined as positive controls for the purpose of ΔΔCt calculation.

NISHIJIMA N., SEIKE M., SOENO C., CHIBA M., MIYANAGA A., NORO R., SUGANO T., MATSUMOTO M., KUBOTA K, & GEMMA A. (2016). miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. International Journal of Oncology, 48(3), 937-944.

+ Open protocol

+ Expand

Quantifying Immune Response Post-Ischemic Stroke

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ischemic hemispheres were harvested from mice 96 hours after MCAO, frozen in liquid nitrogen and stored at −80°C until processed. Total RNA was isolated using the RNeasy Mini Kit according to the manufacturer's instructions. (Qiagen, Valencia, CA). cDNA was synthesized using the SuperScript II Reverse Transcriptase cDNA synthesis kit (Life Technologies, Grand Island, NY). Quantitative real time PCR was performed using the StepOnePlus Real-Time PCR System with TaqMan Gene Expression Array Plates for mouse immune response. cDNA from three mice was pooled per group for gene array plates. Individual samples were analyzed in triplicate for IL-6 (Mm00446190_m1), P-selectin (Mm01295931_m1) and IL-10 (Mm00439614_m1) (Life Technologies, Grand Island, NY) using the ABI7000 Sequence Detection System. GAPDH housekeeping gene was used as an endogenous control. Results were analyzed using DataAssist Software (Life Technologies, Grand Island, NY).

Dotson A.L., Wang J., Saugstad J., Murphy S.J, & Offner H. (2014). Splenectomy reduces infarct volume and neuroinflammation in male but not female mice in experimental stroke. Journal of neuroimmunology, 0, 289-298.

+ Open protocol

+ Expand

Fibroblast Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fibroblasts were plated on 50 µg/mL of BME and treated with 10 µM of i-bodies or 12 µM of AMD3100. After 48 h, RNA was extracted using Trizol reagent and reverse transcribed into cDNA using superscript II reverse transcriptase (Life Technologies) as previously described^{29 (link)}. Complementary DNA (cDNA) was subsequently loaded into a Taqman plate and gene expression analysis were performed using predesigned primers for ACTA2, COL1A1, COL3A1 and FN1. All Taqman analysis was performed using Applied Bio system’s Viia 7 instrument (Life Technologies). The results were then exported, normalized to 18S RNA expression and fold change analyses were calculated using Data Assist software (Life Technologies).

Griffiths K., Habiel D.M., Jaffar J., Binder U., Darby W.G., Hosking C.G., Skerra A., Westall G.P., Hogaboam C.M, & Foley M. (2018). Anti-fibrotic Effects of CXCR4-Targeting i-body AD-114 in Preclinical Models of Pulmonary Fibrosis. Scientific Reports, 8, 3212.

+ Open protocol

+ Expand

Profiling Monocyte miRNA in CD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA enriched with small RNAs was obtained from purified monocytes from HC and active CD patients using mirVana miRNA Isolation Kit (Ambion, Invitrogen, Life Technologies). The small RNA fractions were reverse transcribed using Megaplex RT primers and the expression level of 384 miRNAs was analysed using TaqMan MicroRNA Arrays (Array A) (Applied Biosystems, Life Technologies). Experimental data were analyzed by DataAssist Software (Life Technologies). The relative miRNA expression values were calculated using RNU44 as endogenous control.

Cantó E., Garcia Planella E., Zamora-Atenza C., Nieto J.C., Gordillo J., Ortiz M.A., Metón I., Serrano E., Vegas E., García-Bosch O., Juárez C, & Vidal S. (2014). Interleukin-19 Impairment in Active Crohn’s Disease Patients. PLoS ONE, 9(4), e93910.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!