Human hprt

Tissues were homogenized using TissueLyser II (Qiagen) according to manufacturer/s instructions. RNA isolation was using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), human-HPRT (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-HPRT (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. Changes in expression were calculated using delta delta Ct method.

Total RNA from intima, PBMCs, and BMCs were isolated using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay, GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), snoRNA234 (ID# 001234), human-Hprt (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-Hprt (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03 307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. VE-Cadherin forward primer CACTGCTTTGGGAGCCTTC and reverse primer GGGGCAGCGATTCATTTTTCT were used to detect VE-Cadherin mRNA expression. GAPDH primers are forward AGGTCGGTGTGAACGGATTTG and reverse TGTAGACCATGTAGTTGAGGTCA. Changes in expression were calculated using deltadelta Ct method. Primer sequences are described in (Supplemental Table SII).