Total RNA was extracted from the soybean leaves under the stress-treatment and unstressed using an RNA plant extraction kit (OMEGA, China) according to the manufacture’s instruction, and approximately 1 μg of purified total RNA was reverse transcribed to cDNA in a 20 μL reaction volume using AMV reverse transcriptase (Takara) according to the supplier’s instructions. To analyze the relative transcript levels of selected genes, real-time PCR was performed with specific primers according to the Bio-Rad Real-time PCR system (Foster city, CA, USA) and the SYBR Premix Ex II system (TakaRa Perfect Real Time). The qRT-PCR program was: 95 °C for 30 s;40 cycles of 95 °C for 5 s and 60 °C for 34 s; 95 °C for 15 s. The primers used for RT-PCR are listed in Additional file 4 : Table S9.In each case, three technical replicates were performed for each of at least three independent biological replicates [31 (link)]. Quantities of standard RNA were prepared by diluting cDNA (1, 10− 1, 10− 2, 10− 3, 10− 4, and 10− 5) and only Ct values less than 40 were used to calculate correlation coefficients (R2 values) and amplification efficiencies (E) from the slope generated in Microsoft Excel 2013, based on the eq. E = [10−(1/slope) − 1] × 100%. All PCR assays showed efficiency values between 95% and 110% (Additional file 4 : Table S9) [32 (link)].
Real time pcr system
Manufactured by Takara Bio
Sourced in Japan, China, United States
The Real-Time PCR System is a laboratory instrument used for the amplification and detection of DNA sequences in real-time. It is a versatile tool that enables the quantification of target DNA or RNA molecules during the PCR (Polymerase Chain Reaction) process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Primescript rt pcr kit, by Takara Bio (5 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Sybr premix ex taq 2, by Takara Bio (5 mentions)
Sybr premix ex taq, by Takara Bio (5 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (4 mentions)
Sybr premix ex taq 2 system, by Takara Bio (4 mentions)
Sybr green master mix, by Takara Bio (4 mentions)
Sybr green mix, by Takara Bio (3 mentions)
Primescript rt master mix, by Takara Bio (3 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Primerscript rt reagent kit, by Takara Bio (2 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (2 mentions)
Rnx plus solution, by Takara Bio (2 mentions)
Cdna synthesis kit, by Takara Bio (2 mentions)
Tb green premix ex taq kit, by Takara Bio (2 mentions)
Tb green premix ex taq, by Takara Bio (2 mentions)
Sybr green pcr kit, by Takara Bio (2 mentions)
62 protocols using real time pcr system
1
Relative Transcript Levels Analysis
2
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (#108-95-2; TAKARA) according to standard procedures, and cDNA was synthesized using a reverse transcription kit (#RR036A; TAKARA), following manufacturer’s instructions. Quantitative real-time PCR was performed using SYBR® Green FastMIX® (#RR820A; TAKARA) in a StepOne™ Real-Time PCR System. Primers used in this study are listed in Supplementary Table 1 . mRNA expression was calculated using the 2−ΔΔCt method, and GAPDH or 18S RNA was used as a reference for gene expression. The experiments were repeated at least thrice.
3
Liver RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver was homogenized and total RNA was isolated using the RNeasy kit (Qiagen, Hilden, Germany). A reverse transcription reaction was performed by Taqman Reverse Transcription reagent kit (Takara, Kusatsu, Japan) according to the manufacturer's instructions. The real-time PCR reaction was carried out on Roche real-time PCR system with cDNA sample containing SYBR Green PCR master mix (Takara) and primers. Primer sequences can be made available upon request. Relative expression of mRNA was calculated by the comparative cycle threshold method.
4
Melatonin Regulation of Tight Junction Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed to quantify the mRNA levels of ROCK1/2, ZO-1 and occludin. Total RNA was extracted from RKO cells, which were treated with 0.1% DMSO or melatonin (2 and 3 mM) for 48 h at 37°C, using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 4 µg of total RNA was reverse transcribed using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. The thermocycling conditions were as follows: at 42°C for 2 min, 37°C for 15 min and 85°C for 5 sec. The complementary DNAs were amplified using the SYBR-Green qPCR Master mix (Takara Biotechnology Co., Ltd.) and a Real-Time PCR system. All the primers were synthesized by the Sangon Biotech Co., Ltd. (Shanghai, China) and the sequences are listed in Table I . The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. Relative quantification was performed using the 2−ΔΔCq method (27 (link)) and the results were normalized to those of GAPDH.
5
Intestinal Barrier Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the jejunum using an RNAeasy kit (Aidlab Bio CO.Ltd, Beijing, China) following the manufacturer's protocols. PrimerScript TM RT Reagent kit (TaKaRa, Japan) was used to convert RNA to cDNA. QPCR assays were performed on the Step One Plus real-time PCR System using SYBR Premix Ex Taq dye (TaKaRa, Japan). Primer sequences are listed: claudin-1 (F: GAGGATGGTCACACCGTGGT, R: GGAGGATGCTGTTGTCTCGG), occludin (F: ATGCTTTCTCAGCCAGCGTA, R: AAGGTTCCATAGCCTCGGTC), ZO-1 (zonula occludens 1) (F: ACAGGAGGGAAGCCATTTTCA, R: ATTTAAGGACCGCCCTCTCC), β-actin (F: AGAGCGCAAGTACTCCGTGT, R: ACATCTGCTGGAAGGTGGAC).
6
Quantitative RT-PCR Analysis of Pineapple Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used Trizol method (Invitrogen, Carlsbad, CA, USA) to extract total RNA, and the PrimeScript RT-PCR kit (TaKaRa) was used to do the reverse-transcribed experiment. Real-time PCR was performed to analysis the relative transcript levels of selected genes according to the Bio-Rad Real-time PCR system (Foster City, CA, USA) and the SYBR Premix Ex Taq II system (TaKaRa Perfect Real Time), and the primers used has been listed in Additional file 15 : Table S12. The qRT-PCR program was: 95 °C for 30 s; 40 cycles of 95 °C for 5 s and 60 °C for 34 s; 95 °C for 15 s [61 (link), 62 (link)]. The relative transcript levels of the analyzed pineapple genes were normalized to the transcript levels of AcoActin.
7
Quantifying Gene Expression in Rat NP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from rat NP cells was extracted with TRIzol regent (Invitrogen) and reverse transcribed with a PrimeScript RT Master Mix kit (RR036, Takara, Japan). Then, qRT‑PCR was carried out with a SYBR Premix Ex Taq II kit (RR820, Takara) on a Step One Plus Real-Time PCR system. Primers were: aggrecan, forward 5’-CCCTACCCTTGCTTCTCCA-3’ and reverse 5’-CTTGAGAGGCACTCATCAATGT-3’; Col2A, forward 5’-GACCCCCAGGTTCTAATGG-3’ and reverse 5’GCACCTTTGGGACCATCTT-3’; β‑actin, forward 5’-GCAGAAGGAGATTACTGCCCT-3’ and reverse 5’-GCTGATCCACATCTGCTGGAA-3’.
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
total RNAs were extracted from harvested N. benthamiana protoplasts using Trizol reagent (invitrogen) and treated with RNase-free DNase I. First strand cDNA was synthesized using 1 μg total RNA(Promega). The reaction solution was prepared as follows: an oligo d(T) primer, random primer, and M-MLV reverse transcriptase as instructed. Ten-fold diluted cDNA products were used for qRT-PCR on an Eppendorf Real-Time PCR system using a SYBR Green master mix (Takara). The Nb-actin gene were used as internal reference. All the primers used for RT-PCR are listed in Table S7 . The relative gene expression levels were calculated using the 2−△△CT method.
9
Autophagy Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by RNX-Plus solution (Takara Bio INC, Japan) according to the manufacturer’s instructions. The cDNA was synthesized at a final volume of 20 μl using cDNA synthesis kit (Takara Bio INC, Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses were performed using a SYBR Green mix in the Real-Time PCR System (Takara). Relative gene expression data were calculated using the comparative threshold cycle method (ΔΔCt) with ACTB as housekeeping genes. To assess the specificity of each amplification, dissociation analysis was performed in every run. The primer sequences were as follows:
LC3B: forward, 5′-GGATATAGGTCACCCCTCAG-3′,
reverse, 5′-GTTAAAGGAGTTCCTGTCACC-3′;
Beclin-1: forward, 5′-CTGAAACTGGACACGAGCTTCAAG-3′,
reverse, 5′-TGTGGTAAGTAATGGAGCTGTGAGTT-3′;
ATG7: forward, 5′-ATGCCAGGACACCCTGTGAACTTC-3′,
reverse,5′-ACATCATTGCAGAAGTAGCAGCCA-3′.
LC3B: forward, 5′-GGATATAGGTCACCCCTCAG-3′,
reverse, 5′-GTTAAAGGAGTTCCTGTCACC-3′;
Beclin-1: forward, 5′-CTGAAACTGGACACGAGCTTCAAG-3′,
reverse, 5′-TGTGGTAAGTAATGGAGCTGTGAGTT-3′;
ATG7: forward, 5′-ATGCCAGGACACCCTGTGAACTTC-3′,
reverse,5′-ACATCATTGCAGAAGTAGCAGCCA-3′.
10
Transcriptomic Analysis of T cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!