Mirna 1st strand cdna synthesis kit

Total RNA was isolated from the cells using the TRIzol reagent (Takara, Dalian, China). The PrimeScript RT Reagent Kit (Takara, Japan) was used to synthesize the cDNA of mRNA, while the miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) was used to synthesize the cDNA of miRNA. The amplification reactions were set up using the corresponding amplification primers in conjunction with the SYBR Green PCR Master Mix (Takara, Dalian, China), with each reaction having a total volume of 20 μL. The mRNA expression levels were normalized against the reference genes 18S or U6. Details regarding the primers utilized for qRT-PCR can be found in Table 1. The genome referenced for primer design was Sus scrofa (taxid:9823).

Total RNA extraction from LDM samples followed RNAiso Plus reagent (Takara, Kofu, Japan) protocol; 0.5 cm³ of tissue required 1 mL RNAiso Plus. Extracted RNA samples were measured with an ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA) instrument. We synthesized cDNA using PrimeScript RT Reagent Kit with gDNA Eraser Kit (Takara, Kofu, Japan). For miRNAs, we performed cDNA synthesis according to the protocol of miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Qualified samples were used for subsequent RNA-Seq.

Total cellular RNA was extracted using TRIzol Reagent (Invitrogen, USA) and then reverse transcribed into cDNA by using a iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) or miRNA 1st Strand cDNA Synthesis Kit (Vazyme, China). The resultant cDNA was quantified by SYBR Green Quantitative PCR (Roche, South San Francisco, USA) performed on a PCRmax Eco 48 thermal cycler (Thermo Fisher, USA). Fold-changes in target gene expression were analyzed by the Delta-Delta CT method. The following primers were used. miR-29b, forward primer: 5′-UAGCACCAUUUGAAAUCAGUGUU-3′, reverse primer: 5′-CACUGAUUUCAAAUGGUGCUAUU-3′; ROBO1, forward primer: 5′-CCCGACTTCACTCTCTCCCT-3′, reverse primer: 5′-AAATGGTGGGCTCAGGATGG-3′; SRGAP2, forward primer: 5′-TGAGATGGACTACTCCCGCA-3′, reverse primer 5′TGGTAGCCTAAGTCACAACACT3′; U6, forward primer: 5′-CTCGCTTCGGCAGCACA-3′, reverse primer: 5′-AACGCTTCACGAATTTGCGT-3′; and GAPDH, forward primer: 5′-TGTTCGTCATGGGTGTGAAC-3′, reverse primer: 5′-ATGGCATGGACTGTGGTCAT-3′.

After extracting RNA using Trizol reagent (Invitrogen), the complementary DNA (cDNA) was synthesized using PrimeScript^TM RT Master Mix (Takara, Dalian, China) or miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Next, qRT-PCR was carried out using AceQ qPCR SYBR Green Master Mix (Vazyme) on a CFX96 PCR System (Bio-Rad, Hercules, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 was used as internal control. The primers were shown below: HOTAIR-F: 5'-GAGGGGAGCAGAGTTCAAGT-3', HOTAIR-R: 5'-TGGGAGGCAGCAATAGACAA-3'; miR-874-5p-F: 5'-GGCCCTGAGGAAGAACTGAG-3', miR-874-5p-R: 5'-TGAGATCCAACAGGCCTTGAC-3'; ATG10-F: 5'-AGACCATCAAAGGACTGTTCTGA-3', ATG10-R: 5'-GGGTAGATGCTCCTAGATGTGAC-3'; GAPDH-F: 5'-ACAACTTTGGTATCGTGGAAGG-3', GAPDH-R: 5'-GCCATCACGCCACAGTTTC-3'; U6-F: 5'-CTCGCTTCGGCAGCACA-3', U6-R: 5'-AACGCTTCACGAATTTGCGT-3'.

qRT-PCR was performed to validate the expression levels of DEmRNAs, DElncRNAs, and DEmiRNAs. Total RNA and small RNA were extracted from samples of CuR and CKR using an RNAprep pure Plant Kit (TIANGEN, Cat#DP432, China) and miRcute miRNA isolation kit (TIANGEN, Cat#DP501, China), respectively. First-strand cDNA was synthesized from 1 μg of total RNA with the HiScript® II Q RT SuperMix (Vazyme, Cat#R223, China) for qPCR of mRNA and with the lnRcute lncRNA First-Strand cDNA Synthesis Kit (TIANGEN, Cat#KR202, China) for qPCR of lncRNA. In addition, 1 μg of small RNA was used for cDNA synthesis using a miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Cat#MR101, China) with the stem-loop primer designed by the stem-loop sequence (GTCGTATCCAGGGTCCGAGGTATTCGCACTGGATACGAC) except for the internal reference U6. qPCR was performed on the Bio-Rad CFX Connect RealTime system using ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme, Cat#Q711), lnRcute lncRNA qPCR Detection Kit (TIANGEN, Cat#FP402) and miRNA Universal SYBR® qPCR Master Mix (Vazyme, Cat#MQ101) following the manufacturer’s instructions. The 2^-ΔΔCT method was used to normalize and determine the RNA level relative to an internal reference gene, actin (Cs1g05000.1) or U6. All primers are included in Additional file 9: Table S9.