Log In Sign up
The largest database of trusted experimental protocols

Hexadecylamine

Manufactured by Merck Group
Visit Supplier
Sourced in United States, Germany

Hexadecylamine is a long-chain aliphatic amine commonly used in laboratory settings. It is a colorless, waxy solid at room temperature. Hexadecylamine serves as a key building block for the synthesis of various chemical compounds and materials. Its core function is to act as a starting material or intermediate in diverse chemical reactions and formulations.

Automatically generated - may contain errors

Lab products found in correlation

Oleic acid, by Merck Group (18 mentions) Oleylamine, by Merck Group (12 mentions) Trioctylphosphine, by Merck Group (9 mentions) 1 octadecene, by Merck Group (8 mentions) Dodecylamine, by Merck Group (8 mentions) Sulfur, by Merck Group (7 mentions) Toluene, by Merck Group (6 mentions) Methanol, by Thermo Fisher Scientific (6 mentions) Trioctylphosphine oxide, by Merck Group (5 mentions) Octadecene, by Merck Group (5 mentions) Octadecylamine, by Merck Group (5 mentions) Cadmium oxide, by Merck Group (5 mentions) Methanol, by Merck Group (5 mentions) Selenium, by Merck Group (4 mentions) Toluene, by Thermo Fisher Scientific (4 mentions) Hexane, by Merck Group (4 mentions) Dibenzyl ether, by Merck Group (3 mentions) 1 dodecanethiol, by Merck Group (3 mentions) Citric acid, by Thermo Fisher Scientific (3 mentions) Nitric acid, by Merck Group (3 mentions)

Spelling variants of this product

Hexadecylamine (HDA), (6 citations) 1-hexadecylamine (5 citations)

51 protocols using hexadecylamine

1

Synthesis of Iron Nanoparticles under Inert Atmosphere

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthesis of iron NPs (FeNP) were performed under argon atmosphere by using Fisher–Porter tubes, a glovebox and argon/vacuum lines. Mesitylene (+99%, Acros), toluene (99%, VWR Prolabo), methanol (96% STREM), acetic acid (98% Aldrich), and ethanol (99.9% Aldrich) were dried according to classical procedures. These solvents were distilled and degassed prior use. Iron bistrimethylsilylamide dimer, [Fe(N(SiMe3)2)2]2, was purchased from Nanomeps, hexadecylamine (HDA, Aldrich, 98%), oleic acid (OA, 99%, Alfa Aesar), cyclohexane (Aldrich, 99%), igepal CO-520 (Aldrich, 90%), tetraorthosilicate (TEOS, Aldrich, 98%), ammonia solution (28.0–30%, Sigma–Aldrich), poly(ethyleneglycol)monomethyl ether (PEG-OH) (5 kDa, Aldrich), and 3-(triethoxysilyl)propylisocyanate (TESPIC, Alfa Aesar) were used as received. Hexadecylammonium chloride (HDA.HCl) was prepared according to reference [27 (link)] from hexadecylamine (HDA, Aldrich, 90%). MilliQ water (18 MΩ) was used for all aqueous preparations.
Mathieu P., Coppel Y., Respaud M., Nguyen Q.T., Boutry S., Laurent S., Stanicki D., Henoumont C., Novio F., Lorenzo J., Montpeyó D, & Amiens C. (2019). Silica Coated Iron/Iron Oxide Nanoparticles as a Nano-Platform for T2 Weighted Magnetic Resonance Imaging. Molecules, 24(24), 4629.
+ Open protocol
+ Expand
2

Colloidal Synthesis of Inorganic Nanomaterials

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cadmium oxide (99.5%, powder), 2-ethylhexanoic acid (2-EHA, 99%), 1-octadecene (ODE, technical grade, 90%), oleylamine (OLA, technical grade, 70%), hexadecylamine (technical grade, 90%), trioctylamine (98%), trioctylphisphine (TOP, technical grade, 97%), selenium powder (powder, 100 mesh, 99.5%), zinc oxide (puriss, 99–100%), thiourea (TU, ACS Reagent,>99%), triethylene glycol dimethyl ether (TEGDME, 99%), hexadecylamine (technical grade, 90%), palmitic acid (BioXtra, ≥99%) zinc acetate dihydrate (ACS reagent, ≥99.0%), magnesium acetate tetrahydrate (ACS reagent, ≥98%), aluminium chloride hexahydrate (99%), gallium nitrate hydrate (99.9%), lithium chloride (anhydrous, ACS reagent, ≥99%), tetramethylammonium chloride (TMACl, reagent grade, ≥98%), potassium hydroxide (reagent grade, 90%), dimethyl sulfoxide (DMSO, anhydrous, ≥99.9%), and monoethanolamine (MEA, ACS reagent, ≥99.0%) were purchased from Sigma-Aldrich. n-Hexadecylphosphonic acid (97%) was from PlasmaChem GmbH. Methyl acetate (extra pure, 99%) was from Acros. Hexane, n-octane, toluene, acetone, methanol, ethanol, n-butanol, and isopropyl alcohol of spectroscopy grade were purchased from the local supplier Ekos-1. All reagents were used as received, without purification.
Alexandrov A., Zvaigzne M., Lypenko D., Nabiev I, & Samokhvalov P. (2020). Al-, Ga-, Mg-, or Li-doped zinc oxide nanoparticles as electron transport layers for quantum dot light-emitting diodes. Scientific Reports, 10, 7496.
+ Open protocol
+ Expand
3

Synthesis of Nanomaterials for Bioassays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Phosphate saline buffer (PBS, pH 7.4), methanol, potassium hydroxide, polyoxyethyelene (20), sorbitan monolaurate (Tween 20), sulfuric acid, sodium citrate, tri-sodium citrate, hydrogen peroxide, chloroform and acetone were purchased from FUJIFILM Wako Pure Chemical Ind. Ltd. (Osaka, Japan). Tetramethylbenzidine (TMBZ) was purchased from Dojindo (Kumamoto, Japan). HAuCl4, N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC), bovine serum albumin (BSA), N-hydroxysuccinimide (NHS), 1-octadecene, tellurium (Te), l-cysteine, hexadecylamine (HDA), cadmium oxide (CdO), trioctylphosphine oxide (TOPO), trioctylphosphine (TOP), selenium (Se) and sulfur (S) were purchased from Sigma Aldrich (Saint Louis, MO, USA). Oleic acid was purchased from Nacalai Tesque (Kyoto, Japan).
Chowdhury A.D., Takemura K., Khorish I.M., Nasrin F., Ngwe Tun M.M., Morita K, & Park E.Y. (2019). The detection and identification of dengue virus serotypes with quantum dot and AuNP regulated localized surface plasmon resonance. Nanoscale Advances, 2(2), 699-709.
+ Open protocol
+ Expand
4

Fluorescent Probe Synthesis and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chlorotrimethylsilane, tetramethylammonium hydroxide pentahydrate (TMAH), cadmium oxide (CdO), octadecene (ODE), zinc oxide (ZnO), trioctylphosphine oxide (TOPO), selenium (Se), (3-aminopropyl)trimethoxysilane (3-APTMS), trioctylphosphine (TOP), hexadecylamine (HDA), sulfur, succinic anhydride, rhodamine 6G, N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), HAuCl4·3H2O, tannic acid, TGA, MPA, l-cysteine, and GSH were purchased from Sigma Aldrich Co. LLC. (Saint Louis, MO, USA). Oleic acid was purchased from Nacalai Tesque Inc. (Kyoto, Japan). Methanol, tri-sodium citrate and potassium hydroxide (KOH), methanol, acetone, and chloroform were purchased from Wako Pure Chemical Ind. Ltd. (Osaka, Japan). An ultrapure Milli-Q Water System was used for sample preparation. The MB and synthetic DNA targets were purchased from FASMAC Co. Ltd. (Atsugi, Kanagawa, Japan). Black hole quencher-2 (BHQ-2) was used as the fluorescence quencher.
MB sequence: 5′-/NH2/GCGACTTTCAGTTATTATGCCGTTGTATTTGTCGC/BHQ-2/-3′
Full complementary DNA: AAATACAACGGCATAATAACTGAAA
Single nucleotide DNA: AAATACAACGTCATAATAACTGAAA
Noncomplementary DNA: TGAAGCTAACCGGTAAGCGCTATAG
The bold sequence is the stem sequence of the MB.
Adegoke O, & Park E.Y. (2016). Gold Nanoparticle-Quantum Dot Fluorescent Nanohybrid: Application for Localized Surface Plasmon Resonance-induced Molecular Beacon Ultrasensitive DNA Detection. Nanoscale Research Letters, 11, 523.
+ Open protocol
+ Expand
5

Synthesis and Characterization of Lipid Structures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hexadecylamine, 5-chloro-2-nitrobenzotrifluoride, and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) were purchased from Sigma-Aldrich, and silica gel (100–200 mesh) was purchased from S.D Fine Chemicals Private Limited. Other chemicals were purchased from Loba Chemie or Merck Limited unless mentioned otherwise. Solvents used were analytically pure and used without further purification.
Sharma N., Dhyani A.K., Marepally S, & Jose D.A. (2019). Nanoscale lipid vesicles functionalized with a nitro-aniline derivative for photoinduced nitric oxide (NO) delivery. Nanoscale Advances, 2(1), 463-469.
+ Open protocol
+ Expand
6

Formulation and Characterization of Hyaluronate Nanocarriers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Low molecular weight Na hyaluronate was used (Bioiberica, Barcelona, Spain), which was measured by capillary viscosimetry as about 50 kDa. Dodecyl amine (DDA), hexadecyl amine (HDA), and cholesterol (CHOL) were from Sigma-Aldrich (Milan, Italy). Pyrene was from Fluka (Milan, Italy). Clotrimazole (CLO) was obtained from Sifavitor (Casaletto Lodigiano, Lodi, Italy). Ketoconazole was used as an internal standard and obtained from Erregierre (San Paolo D’Argon, Bergamo, Italy). All the other reagents were from Carlo Erba (Milan, Italy).
Catenacci L., Marrubini G., Sorrenti M., Rossi S., Sandri G., Ferrari F., Fagnani V., Valentino C, & Bonferoni M.C. (2020). Design of Experiments-Assisted Development of Clotrimazole-Loaded Ionic Polymeric Micelles Based on Hyaluronic Acid. Nanomaterials, 10(4), 635.
+ Open protocol
+ Expand
7

Synthesis of Colloidal Nanocrystals

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cadmium oxide (CdO, ≥99.99%), selenium (≥99.99%), trioctylphosphine oxide (TOPO, 90%), trioctylphosphine (TOP, 97%), hexadecylamine (HDA, 90%), oleic acid (OLA, 90%), 1-octadecene (ODE, 90%), 1-octanethiol (≥98%) and 3-mercaptopropionic acid (MPA, ≥99%) were purchased from Sigma-Aldrich. PEG5000k-methoxy (PEG-OMe, PLS-604), and PEG5000k-hydroxyl (PEG-OH, PBL-8083) were purchased from Creative PEGWorks. Hexanes (≥98.5%), toluene (≥99.5%), acetone (≥99.5%), methanol (≥99.8%) and citric acid (≥99.5%) were purchased from Fischer Scientific. All reagents were used as received, without further purification.
Zhang M., Bishop B.P., Thompson N.L., Hildahl K., Dang B., Mironchuk O., Chen N., Aoki R., Holmberg V.C, & Nance E. (2019). Quantum dot cellular uptake and toxicity in the developing brain: implications for use as imaging probes. Nanoscale Advances, 1(9), 3424-3442.
+ Open protocol
+ Expand
8

Synthesis of Colloidal Nanocrystals

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cadmium oxide (CdO, ≥99.99%), selenium (≥99.99%), trioctylphosphine oxide (TOPO, 90%), trioctylphosphine (TOP, 97%), hexadecylamine (HDA, 90%), oleic acid (OLA, 90%), 1-octadecene (ODE, 90%), 1-octanethiol (≥98%) and 3-mercaptopropionic acid (MPA, ≥99%) were purchased from Sigma-Aldrich. PEG5000k-methoxy (PEG-OMe, PLS-604), and PEG5000k-hydroxyl (PEG-OH, PBL-8083) were purchased from Creative PEGWorks. Hexanes (≥98.5%), toluene (≥99.5%), acetone (≥99.5%), methanol (≥99.8%) and citric acid (≥99.5%) were purchased from Fischer Scientific. All reagents were used as received, without further purification.
Zhang M., Bishop B.P., Thompson N.L., Hildahl K., Dang B., Mironchuk O., Chen N., Aoki R., Holmberg V.C, & Nance E. (2019). Quantum dot cellular uptake and toxicity in the developing brain: implications for use as imaging probes. Nanoscale Advances, 1(9), 3424-3442.
+ Open protocol
+ Expand
9

Synthesis of Monodisperse Iron Oxide Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
All reactants used were commercially available: hexadecylamine (HDA) 98% purity, oleic acid (OA) 99% purity, iron pentacarbonyl, dibenzyl ether 98% purity, ethyl acetate (99.5% purity), tetramethylammonium hydroxide (TMAH) solution in water (25% wt), and benzyl ether (98% purity) were purchased from Sigma-Aldrich Saint Louis, MO, USA and were used as received. Absolute ethanol and n-hexane 99% reagent grade were supplied by Scharlau, Cham Germany.
Reyes-Ortega F., Delgado Á.V, & Iglesias G.R. (2021). Modulation of the Magnetic Hyperthermia Response Using Different Superparamagnetic Iron Oxide Nanoparticle Morphologies. Nanomaterials, 11(3), 627.
+ Open protocol
+ Expand
10

Synthesis of Semiconductor Nanocrystals

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cadmium oxide (CdO, 99.5%), trioctylphosphine
oxide (99%), trioctylphosphine (TOP, 97%), selenium powder (Se, 99.99%),
and lead(II) acetate trihydrate (Pb(CH3CO2)2·3H2O, 99.999%) were purchased from Strem
Chemicals. Octadecylphosphonic acid (99%) was purchased from Polycarbon
Industries. Copper(II) acetylacetonate (Cu(acac)2, 97%),
hexadecylamine (98%), tetrakis(acetonitrile)copper(I) hexafluorophosphate
(99.99%), octadecene (technical grade, 90%), 1-dodecanethiol (≥98%),
oleylamine (70%), tetrachloroethylene (≥99%), anhydrous chloroform,
methanol, toluene, and tetrahydrofuran were purchased from Sigma-Aldrich.
All chemicals were used without any further purification.
Gariano G., Lesnyak V., Brescia R., Bertoni G., Dang Z., Gaspari R., De Trizio L, & Manna L. (2017). Role of the Crystal Structure in Cation Exchange Reactions Involving Colloidal Cu2Se Nanocrystals. Journal of the American Chemical Society, 139(28), 9583-9590.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!