gRNA vectors were constructed using Uracil-Specific Excision Reagent (USER) friendly cloning as previously described (Ronda et al., 2014 (link)). The CHO codon-optimized dCas9 cassette was generated from a synthesized CHO codon-optimized wild-type Cas9 (GeneArt, Thermo Fisher Scientific) as previously described (Xiong et al., 2019 (link)). The CHO codon-optimized dCas9 was then fused to a VPR domain cloned from a AAV_NLS-SaCas9-NLS-VPR vector (a gift from George Church (Addgene plasmid #68496)). The construct is here referred to as VPR_dCas9 and available at Addgene (Addgene Plasmid #134601). The plasmid construct and sequence are listed in Supplementary Figure S3 . All plasmids were purified using NucleoBond Xtra Midi EF (Macherey-Nagel) according to manufacturer’s protocol and verified by Sanger sequencing.
Nucleobond xtra midi ef
Manufactured by Macherey-Nagel
Sourced in Germany
NucleoBond Xtra Midi EF is a laboratory equipment product manufactured by Macherey-Nagel. It is designed for the purification of plasmid DNA. The product utilizes an anion-exchange resin to selectively bind and separate plasmid DNA from other cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Genemorph 2, by Agilent Technologies (2 mentions)
Xl1 red competent cells, by Agilent Technologies (2 mentions)
Plenti fnls p2a puro, by Addgene (2 mentions)
Plenti abera p2a puro, by Addgene (2 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Geneart, by Thermo Fisher Scientific (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Guide it sgrna in vitro transcription kit, by Takara Bio (1 mentions)
Neon transfection system, by Thermo Fisher Scientific (1 mentions)
Transit x2 reagent, by Mirus Bio (1 mentions)
Neuron dissociation solution, by Fujifilm (1 mentions)
Dulbecco modified eagle medium (dmem), by Fujifilm (1 mentions)
Penicillin streptomycin solution, by Fujifilm (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Top 10 escherichia coli cells, by Thermo Fisher Scientific (1 mentions)
Human genomic dna, by Roche (1 mentions)
Pgl3 enhancer vector, by Promega (1 mentions)
Prl tk, by Promega (1 mentions)
Pcmv myc, by Takara Bio (1 mentions)
21 protocols using nucleobond xtra midi ef
1
Construction of VPR_dCas9 Expression Plasmid
2
Generation of Tau, Fyn, and Pyk2 Expression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tau-V5 and Fyn-Myc expression constructs were generated using pENTR donor vectors that contained full-length human 2N4R tau and human Fyn [26 (link)]. pDONR223-PTK2B was a generous gift from William Hahn and David Root (Addgene plasmid # 23898). The human Pyk2 cDNA was derived from the pDONR223-PTK2B vector and subcloned into an mThy1.2 expression vector to generate Pyk2 transgenic mice. Pyk2-V5 and Pyk2-GFP vectors were generated by cloning the Pyk2 cDNA into pcDNA6.2/V5-DEST and pcDNA6.2/N-EmGFP-DEST vectors (Gateway cloning, Thermo Fisher Invitrogen). Fyn-GFP was constructed in a similar manner. Mutagenesis of Pyk2 to generate Pyk2Y402F, Tau to generate TauY18A (Y18 is a Fyn phosho-epitope) and Fyn to generate FynKD (K299A, kinase-dead), FynCA (Y531F, constitutively active), FynΔSH2 (SH2 domain (149-246 aa)-deleted) and FynΔSH3 (SH3 domain (82-143 aa)-deleted) constructs was performed following the manufacturer’s instructions (Q5 site-directed mutagenesis kit, New England Biolabs, E0554S). A DNA purification kit (NucleoBond Xtra Midi-EF, MACHEREY-NAGEL) was used for plasmid preparation. ON-TARGET plus human PTK2B siRNA (L-003165-00-0005) smart pool and non-targeting pool control siRNAs were purchased from Dharmocon. Co-transfection of the siRNA and the Tau-V5 plasmid was performed using the DharmaFECT 1 transfection reagent.
3
CRISPR-Cas9 Genome Editing in HEK 293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the genome-editing, the DNA-directed RNA-guided endonuclease (RGEN) system (TakaraBio) was used [20 (link)]. Designed gRNA sequence was integrated into the expression vector under the U6 promotor (pRGEN_U6_SG). Cas9 endonuclease was integrated into the expression vector under the CMV promotor (pRGEN-Cas9-CMV). These plasmids were transfected into E.coli and purified by the NucleoBond Xtra Midi EF (Macherey-Nagel). The 71–78 bp long single-stranded oligonucleotide (ssODN) (100 pmol) was transfected along pRGEN_U6_SG (0.17 μg) and pRGEN-Cas9-CMV (0.25 μg) vectors into 1.75 × 105 HEK 293 T/17 cells by using TransIT-X2 reagent (Mirus Bio). Then the cells were cultured in 24 well tissue culture plates for 3 days. As an alternative method for 4 genes (AKT3, BIM, IGF2 and MYCN), gRNA was prepared by in vitro transcription (IVT) using Guide-it sgRNA In Vitro Transcription Kit (Takara) and was transfected with Cas9 protein by the Neon Transfection System (Thermo Fisher Scientific) with two pulses of 1100 V and 20 ms.
Regarding the method of introducing the Cas9, a transfection of the Cas9 proteins as a complex with gRNA (RNP) was used in the later experiment [20 (link)], instead of the standard expression vector method.
Regarding the method of introducing the Cas9, a transfection of the Cas9 proteins as a complex with gRNA (RNP) was used in the later experiment [20 (link)], instead of the standard expression vector method.
4
Cell Culture and Plasmid Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells and NIH/3T3 cells were obtained from RIKEN BioResource Research Center (Cell ID: RCB2202) and Cell Resource Center for Biomedical research/Cell Bank, Tohoku University (Cell ID: TKG 0299), respectively. Cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (041–30081, FUJIFILM-Wako Pure Chemical Corp.) supplemented with 10% fetal bovine serum (FBS) (Sigma-aldrich) and penicillin-streptomycin solution (168–23191, FUJIFILM-Wako Pure Chemical Corp.) at 37°C, 5% CO2 in a humidified atmosphere. Primary cultures of neurons were prepared from the cerebral cortex of rat embryos (033–24871, FUJIFILM-Wako Pure Chemical Corp.) using a neuron dissociation solution (291–78001, FUJIFILM-Wako Pure Chemical Corp.). Neurons were cultured in the neuron culture medium (148–09671, FUJIFILM-Wako Pure Chemical Corp) at 37°C, 5% CO2 in a humidified atmosphere, and half the volume of the culture medium was replaced with fresh medium every 3 days. To prevent the growth of astrocytes, 5-mM AraC was added to the medium if necessary. For preparation of plasmids, E. coli DH5a obtained from TOYOBO (DNA-903F) was cultured in Lysogeny Broth medium supplemented with antibiotics at 30°C or 37°C. Plasmids were purified by using NucleoBond Xtra Midi EF (Cat# 740420, MACHEREY-NAGEL).
5
Cloning and Characterization of DEC2 and IL-1β Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DEC2 (NM_030762) cDNA was amplified from human primary fibroblast total cDNA and was inserted into pcDNA3.1 V5 hisA vector (Thermo Fisher Scientific). The following primers were used for DEC2 cDNA amplification: sense 5’-AACGAAGGATCCGCCACCATGGACGAAGGAATTCCTCATTTGCA-3’ and antisense 5’-GGACGCCTCGAGTCAGGGAGCTTCCTTTCCTGGCT-3’ .
2 kb part of IL-1β promoter (NG_008851.1) was amplified from Human Genomic DNA (Roche Basel, Switzerland; cat# 11691112001) and inserted into pGL3-Enhancer vector (Promega Corporation, Fitchburg, USA). The following primers were used for amplification: sense5’-AATTTGGGTACCAATGCTGTCAAATTCCCATTCACCCA-3’ and antisense 5’-TACTTCCTCGAGGGCTGCTTCAGACACTTGAGCA-3’ . The constructs were validated by using nucleotide sequencing.
For dual-luciferase assay the control vector was pRL-TK (Promega). Vectors were propagated in competent TOP10 Escherichia Coli cells (Thermo Scientific). Ultrapure endotoxin-free plasmid DNA was prepared using NucleoBond® Xtra Midi EF (Macherey-Nagel, Düren, Germany; cat# 740420) according to the manufacturer’s instructions. Plasmid DNA was diluted in a sterile water.
2 kb part of IL-1β promoter (NG_008851.1) was amplified from Human Genomic DNA (Roche Basel, Switzerland; cat# 11691112001) and inserted into pGL3-Enhancer vector (Promega Corporation, Fitchburg, USA). The following primers were used for amplification: sense
For dual-luciferase assay the control vector was pRL-TK (Promega). Vectors were propagated in competent TOP10 Escherichia Coli cells (Thermo Scientific). Ultrapure endotoxin-free plasmid DNA was prepared using NucleoBond® Xtra Midi EF (Macherey-Nagel, Düren, Germany; cat# 740420) according to the manufacturer’s instructions. Plasmid DNA was diluted in a sterile water.
6
Plasmid Generation for TRAPPC10 and TRAPPC11
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For generation of plasmids coding for Myc-tagged ASH domains from human TRAPPC10 (amino acid residues 1000-1259) and TRAPPC11 (residues 701-1133; transcript variant 1), the corresponding cDNA regions were PCR-amplified from retinal pigment epithelial cell cDNA [43 (link)] by standard procedures using forward (CAGAATTCTCCCCATCTACAGCAAGCAGTC for TRAPPC10; CAGAATTCTCTTAAATTGGCAGGGAGGAGGAGGA for TRAPPC11) and reverse (CAGGTACCTCATGTTACACTGACTTCCAGG for TRAPPC10; CAGGTACCTCATGCAGCAGCAATAGAGGTAT for TRAPPC11) primers containing EcoR1 and Kpn1 restriction sites (italics), respectively. The PCR products were cloned into pCMV-Myc (Clontech laboratories, Inc.) and transformed into Escherichia coli DH10α using standard procedures. Plasmids from recombinant bacteria were purified using endotoxin-free plasmid DNA purification kit (NucleoBond Xtra Midi EF) from Macherey-Nagel and the inserts sequenced at Eurofins MWG Operon.
7
Construction of PUb-RL and FerLCH-FFL Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A gene cassette containing the Ae. aegypti polyubiquitin promoter-Renilla luciferase (PUb-RL) was excised from pSLfa-PUb-RL [33 (link)] using MluI and EcoRI (NEB) and treated with mung bean nuclease (NEB) to make the ends blunt. A separate plasmid containing the Ae. aegypti ferritin light chain (AAEL007383) promoter-firefly luciferase (FerLCH-FFL) [20 (link)] gene was linearized 3’ of the FFL ORF using PshAI and treated with shrimp alkaline phosphatase (NEB). The PUb-RL fragment was ligated into the linearized pGL3-LCH-FFL, and only tail-to-tail orientation constructs were sequenced to confirm the direction and integrity of the insert. A sequence-confirmed clone was purified using the endotoxin-free Midiprep (NucleoBond Xtra Midi EF, Machery-Nagel) for transfection.
8
Construction of SpCas9 Mutant Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SpCas9 mutant libraries were constructed using three independent protocols. For the first library, the Cas9 library plasmid was transformed into XL1-red competent cells (Agilent), which were grown according to instructions in the vendor's manual. For the second and third libraries, error-prone PCR was performed on whole WT-SpCas9 from Cas9 library plasmid sequences using Genemorph II (Agilent) and Diversify PCR random mutagenesis (Clontech) kits under low error rate (0–5 mutations per kb) conditions with primers designed for Gibson Assembly (Supplementary Table 3 ); PCR products were subsequently gel purified (4.3 kb). The purified randomly mutagenized library and the backbone of the Cas9 library plasmid (double-digested with BamHI and XbaI, followed by gel purification of the 3 kb fragment) were Gibson assembled. The assembled libraries were transformed into Endura™ electrocompetent cells (Lucigen) and incubated on chloramphenicol LB plates (12.5 μg/mL) at 37 °C overnight. A total of 3 × 106 colonies were obtained for each library, resulting in a library complexity of 107 overall. Pooled library plasmids were purified using a midi prep kit (NucleoBond Xtra Midi EF, Macherey-Nagel).
9
Construction of Mammalian Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described in the Supporting Information of [49 (link)], the mammalian expression vectors were constructed with pcDNA3.1(+)-puro (from the Don Ganem laboratory, University of California San Francisco). ORF1-Flag amplicons, containing a 5′ BamH1-Kozak sequence and 3′ EcoRI-FLAG sequence, were generated by PCR with a high-fidelity polymerase from WT or mutant ORF1 pRTC2 templates with the forward primer CGCGGATCCGCAATGGGGAAAAAACAGAAC and reverse primer GCCGGAATTCCTACTTGTCGTCGTCGTCCTTATAATCCATTTTGGCATG. The PCR fragment was inserted into pcDNA3.1(+)-puro. Some mutants were made using WT pORF1-FLAG as a template for site-directed mutagenesis. All mutations were verified by DNA sequencing, and plasmid DNA was purified using the endotoxin-free plasmid DNA purification kit, NucleoBond Xtra Midi EF (Macherey-Nagel). These plasmids were used to compare expression of the various ORF1p constructs.
10
CRISPR/Cas9-Mediated Targeted Integration of Transgenes in CHO Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!