Platinum taq dna polymerase

Manufactured by Takara Bio

Sourced in Japan, China

Platinum Taq DNA polymerase is a thermostable DNA polymerase enzyme used for PCR amplification of DNA. It catalyzes the synthesis of new DNA strands complementary to a DNA template.

Automatically generated - may contain errors

Lab products found in correlation

Pcr reaction buffer, by Takara Bio (2 mentions) Radioimmunoprecipitation assay ripa buffer, by Cell Signaling Technology (1 mentions) Celltiter 96 aqueous one solution cell proliferation assay mts kit, by Promega (1 mentions) Turbo transfer buffer, by Bio-Rad (1 mentions) Protease inhibitor cocktail, by Cell Signaling Technology (1 mentions) Tris hcl precast gel, by Bio-Rad (1 mentions) Trypsin edta, by Thermo Fisher Scientific (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (1 mentions) Pvdf membrane, by Bio-Rad (1 mentions) Restriction endonuclease, by Takara Bio (1 mentions) Oligonucleotide primers, by Sangon (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Primescript 2 first strand cdna synthesis kit, by Takara Bio (1 mentions)

6 protocols using platinum taq dna polymerase

Soil DNA Extraction and 16S rRNA Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genomic DNA was directly extracted from the soil using an E.Z.N.A.^® Soil DNA kit (Omega Bio-Tec, Inc., USA) according to the manufacturer’s instructions. The quality of the extracted DNA was preserved using 1% agarose gels. The V3–V4 hypervariable regions of 16 S rRNA were amplified via PCR from the microbial genomic DNA using barcoded fusion primers (forward primers:
341 F CCTACACGACGCTCTTCCGATCTN (barcode) CCTACGGGNGGCWGCAG, reverse primers: 805 R GACTGGAGTTCCTTGGCACCCGAGAATTCCAGACTACHVGGGTATCTAATCC). The reaction mixtures (50 µl) contained 5 µl of 10 × PCR reaction buffer (TakaRa, Japan), 10 ng of DNA template, 0.5 µl of each primer, 0.5 µl of dNTPs and 0.5 µl of Platinum Taq DNA polymerase (TakaRa, Japan). The PCR conditions were as follows: 94 °C for 3 min, 94 °C for 30 s, annealing at 45 °C for 20 s and 65 °C for 30 s, which was repeated for 5 cycles, followed by 94 °C for 20 s, 55 °C for 20 s and 72 °C for 30 s, which was repeated for 20 cycles, before a final elongation at 72 °C for 5 min. The PCR product was excised from the 1.5% agarose gel and purified using a QIAquick Gel Extraction Kit.

Han G., Lan J., Chen Q., Yu C, & Bie S. (2017). Response of soil microbial community to application of biochar in cotton soils with different continuous cropping years. Scientific Reports, 7, 10184.

+ Open protocol

+ Expand

Nrf2 Regulation: Chemical and Molecular Insights

Check if the same lab product or an alternative is used in the 5 most similar protocols

LUT (Figure 1A for structure; purity: > 98%) was obtained from Dalian Meilun Biotech Corp (Dalian, China). Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin (10,000 U/ml), and trypsin-EDTA were supplied by Gibco (Grand Island, NY, USA). A Cell-Titer 96 Aqueous One Solution Cell Proliferation (MTS) Assay Kit was obtained from Promega (Madison, WI, USA). Platinum Taq DNA polymerase was purchased from Takara (Mountain View, CA, USA). Power SYBR Green PCR Master Mix was purchased from Applied Biosystems (Carlsbad, CA, USA). Tris-HCl precast gels, turbo transfer buffer, and PVDF membranes were obtained from Bio-Rad (Hercules, CA, USA). Tris-Glycine-SDS running buffer and Super Signal enhanced chemiluminescent substrate were purchased from Boston BioProducts (Ashland, MA, USA) and Thermo Scientific (Rockford, IL, USA), respectively. An antibody against Nrf2 was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Protease inhibitor cocktail, radioimmunoprecipitation assay (RIPA) buffer, and antibodies against HO-1, NQO1, β-actin, HDACs (HDAC1-7) and DNMTs (DNMT1, DNMT3a/b) were supplied by Cell Signaling Technology (Beverly, MA, USA).
All other chemicals, unless otherwise noted, were obtained from Sigma (St. Louis, MO, USA).

Zuo Q., Wu R., Xiao X., Yang C., Yang Y., Wang C., Lin L, & Kong A.N. (2018). The Dietary Flavone Luteolin Epigenetically Activates the Nrf2 Pathway and Blocks Cell Transformation in Human Colorectal Cancer HCT116 Cells. Journal of cellular biochemistry, 119(11), 9573-9582.

+ Open protocol

+ Expand

Blood Genomic DNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were obtained from Sigma (Saint Louis, USA) except as noted. The EZgene™ Blood Genomic DNA Miniprep Kit, Platinum Taq DNA polymerase, restriction endonucleases, and associated buffers were obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). The Bovine Complement 3 ELISA Kit was obtained from BlueGene (Shanghai, China). Oligonucleotide primers were obtained from Sangon Biological Engineering (Shanghai, China). DNA sequencing was performed by TaKaRa (Dalian, China).

Wang Y., Zhai J., Yang C., Wang J., Sun Y., Li Y., Ju Z., Huang J, & Wang C. (2022). Complement component 3 haplotypes influence serum complement activity and milk production traits in Chinese Holstein cattle. PLoS ONE, 17(6), e0268959.

+ Open protocol

+ Expand

Mosquito Species Identification by PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

One leg of a single mosquito was used for DNA extraction with the EZNA™ Micro Elute Genomic DNA Kit (Promega, Madison, WI). Molecular identifications of An. sinensis and An. vagus species were conducted using species-specific PCR primers (forward: TGTGAACTGCAGGACACATGAA and reverse: AGGGTCAAGGCATACAGAAGGC for An. sinensis; forward: CACACATCCTTGAGTGCTA and reverse: ACACATCACTTGAGGCCAC for An. vagus) to amplify the second internal transcribed spacer (ITS2) and 28S-D3 rDNA regions
[44 (link),45 (link)]. Amplification was performed in a 25 μL reaction containing 2 μL of template DNA, 2.5 μL of 10 × PCR buffer, 0.75 μL of 50 mM MgCl₂, 2 μL of 2.5 mM of each dNTP, 0.5 μL of 10 μM of each primer, and 0.625unit Platinum®Taq DNA Polymerase (TaKaRa, China). The cycling conditions were as follows: initial denaturation at 94°C for 2 min, 30 cycles of 30s denaturation at 94°C, 30s annealing at 48°C and 30s extension at 72°C followed by a final extension of 10 min at 72°C. Amplification products were examined on a 2.5% agarose gel electrophoresis. The species was determined by the size of the PCR product (1,077 bp for An. sinensis and 604 bp for An. vagus). Molecular identification was conducted for all mosquitoes subjected to insecticide resistance bioassay.

Qin Q., Li Y., Zhong D., Zhou N., Chang X., Li C., Cui L., Yan G, & Chen X.G. (2014). Insecticide resistance of Anopheles sinensis and An. vagus in Hainan Island, a malaria-endemic area of China. Parasites & Vectors, 7, 92.

+ Open protocol

+ Expand

Quantifying Osteogenic Marker Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol (Invitrogen). The cDNAs were synthesized with the use of a PrimeScript^® II first-strand cDNA synthesis kit (Takara Bio Inc., Otsu, Shiga, Japan) after 10 µg of total RNA obtained from the individual samples were reverse-transcribed separately with Superscript II RT. Briefly, 1 μL of each cDNA was diluted in 25 μL of reaction mixture including 1 × PCR buffer, 1.5 mM MgCl₂, 200 μM of each dNTP, 0.5 units of Platinum Taq DNA polymerase (TAKARA Bio, Shiga, Japan), and 0.5 μM of each specific primer set.
Primers for RUNX2, osteopontin, DLX5, osterix, and osteocalcin were used as follows: RUNX2: sense 5′-GATGACACTGCCACCTCTGA-3′, antisense 5′-CAGCGTCAACACCATCATTC-3′; osteopontin: sense 5′-TCTGATGAGACCGTCACTGC-3′, antisense 5′-TGTCCTTGTGGCTGTGAAAC-3′; DLX5: sense 5′-TCTCTAGGACTGACGCAAACA-3′, antisense 5′-GTTACACGCCATAGGGTCGC-3′; ssterix: sense 5′-GATAGTGGAGACCTTGCTCGTAG-3′, antisense 5′-GAGGTCACAGGGTATGAGAAGAG-3′; osteocalcin: sense 5′-AGGACCATCTTTCTGCTCACTC, antisense 5′-CTGCCAGAGTTTGGCTTTAG.

Takabatake K., Matsubara M., Yamachika E., Fujita Y., Arimura Y., Nakatsuji K., Nakano K., Nagatsuka H, & Iida S. (2021). Comparing the Osteogenic Potential and Bone Regeneration Capacities of Dedifferentiated Fat Cells and Adipose-Derived Stem Cells In Vitro and In Vivo: Application of DFAT Cells Isolated by a Mesh Method. International Journal of Molecular Sciences, 22(22), 12392.

+ Open protocol

+ Expand

Soil DNA Extraction and 16S rRNA Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from the soil samples using an E.Z.N.A. soil DNA kit (Omega Bio-Tec, Inc., USA) as per the manufacturer's guidelines. The obtained DNA was assessed by loading 10 μL of the samples and running them on 1% agarose gel. The barcoded fusion primers (forward primers: 341F: CCTACACGACGCTCTTCCGATCTNCCTAC GGGNGGCWGCAG, reverse primers:
were used in the amplification of the V3-V4 hypervariable regions of 16S rRNA via PCR from the microbial genomic DNA. The PCR reaction mixture (50 μl) comprised of 5 μl of 10 × PCR reaction buffer (TakaRa, Japan), 10 ng of DNA template, 0.5 μl of each primer, 0.5 μl of dNTPs and 0.5 μl of Platinum Taq DNA polymerase (TakaRa, Japan). Thermocycler amplification conditions were set at: initial 94ºC for 3 min, 94ºC for 30 s, annealing at 45ºC for 20 s and 65ºC for 30 s, which was repeated for 5 cycles, followed by 94ºC for 20 s, 55ºC for 20 s and 72ºC for 30 s, which was repeated for 20 cycles, before a final elongation at 72ºC for 5 min. Specificity assessment of the PCR amplification product was assessed on 1.5% agarose gel and thereafter purified using a QIAquick Gel Extraction Kit.

Han G., Quan-qiu C., Zhang S., Li G., Yi X., Feng C., Cui Y., & Jia-yang L. (2020). Variations in Fungal Diversity in a Biochar-Treated Continuous Cotton-Cropped Soil Environment Through Metagenomics-Based Analyses. Polish Journal of Environmental Studies, 29(5), 3143-3152.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!