ChIP assay was performed using the Magna ChIP Assay Kit (Millipore) according to the manufacturer’s instructions68 (link). Three million chondrocytes were fixed in 37% formaldehyde, pelleted, and resuspended in lysis buffer. The cells were sonicated and centrifuged to remove insoluble material. The supernatants were collected, and protein G magnetic beads were added and incubated for 1 h at 4 °C with anti-HPIP (Proteintech, 1:50, 12102-1-AP), anti-LEF1 (Abcam, 1:50, ab137872), H3K4ac (Abcam, 1:50, ab176799), H3K9ac (Abcam, 1:50, ab10812), H3K14ac (Abcam, 1:50, ab52946), H3K56ac (Abcam, 1:25, ab71956). The chromatin was collected, purified, and de-crosslinked at 62 °C for 2 h, followed by incubation at 95 °C for 10 min. The DNA was isolated using the ChIP DNA Clean & Concentrator kit (Zymo Research Corp.) according to the manufacturer’s instructions. The precipitated DNA fragments were quantified through RT-PCR analysis. For re-ChIP, complexes were eluted from the primary immunoprecipitation by incubation with 10 mM DTT at 37 °C for 30 min and diluted 1:50 in re-ChIP buffer (150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8.1) followed by re-immunoprecipitation with the second antibodies. RT-PCR was performed to detect relative occupancy.
Magna chip assay kit
Manufactured by Merck Group
Sourced in United States
The Magna ChIP Assay Kit is a tool used for chromatin immunoprecipitation (ChIP) experiments. It provides reagents and protocols to enrich for DNA fragments bound by specific proteins of interest. The kit enables researchers to study protein-DNA interactions and epigenetic modifications within a cellular context.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green incorporation, by Thermo Fisher Scientific (2 mentions)
Chip dna clean concentrator kit, by Zymo Research (1 mentions)
7900ht rt pcr instrument, by Bio-Rad (1 mentions)
Itaq universal sybr green supermix form, by Bio-Rad (1 mentions)
Ab32129, by Abcam (1 mentions)
Ab52946, by Abcam (1 mentions)
Ab205718, by Abcam (1 mentions)
Anti creb, by Abcam (1 mentions)
Ab50887, by Abcam (1 mentions)
Magna chip protocol, by Merck Group (1 mentions)
Amersham imager 600, by GE Healthcare (1 mentions)
Amersham imager, by Cytiva (1 mentions)
Anti p53, by Merck Group (1 mentions)
Anti p53, by Santa Cruz Biotechnology (1 mentions)
Hotstartaq master mix, by Qiagen (1 mentions)
Bioruptor, by Cosmo Bio (1 mentions)
22 protocols using magna chip assay kit
1
Chromatin Immunoprecipitation Assay Protocol
2
ChIP-Seq Protocol for Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were implemented using Magna ChIP Assay kit (Millipore) following the manufacturer's instruction. In short, tissues were fixed with 1% formaldehyde and collected on ice with ChIP lysis buffer. Afterward, the DNA was sonicated and next, the supernatant was obtained and cultured with dynabeads protein G that had been conjugated with anti‐SP1, anti‐HDAC1 and anti‐acetylated histone antibodies. IgG was utilized as a negative control. ChIP‐derived DNA was quantified with qRT‐PCR with SYBR Green incorporation (Applied Biosystems) [21 (link)].
3
ChIP Assay Using Magna Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using the Magna ChIP Assay Kit (Millipore) according to the manufacturer's instructions. The collected DNA fragments were quantified by qPCR with listed primers (Table S2 ).
4
ChIP-qPCR analysis of TNF-α signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells at 80% confluency were treated with TNF-α or PBS (vehicle). ChIP analysis was performed using the Millipore Magna ChIP assay kit protocol (cat# 17-610). For the immunoprecipitation, 2 μg of appropriate antibody was used for each condition and incubated overnight at 4ºC, with lysates from 106 cells. Quantitative real-time PCR (RT-PCR) was performed with the Applied Biosystems 7900HT RT-PCR instrument using the iTaq Universal SYBR Green Supermix form Bio-Rad (cat. # 172-5121).
The primer sequences were as follows:
Intergenic region 8000 upstream IL-6 promoter:
For. 5′- GCTCCTCCATCTGGTGTCAT-3′, Rev.5′-AAATTGGGGGTAGGGTTGTC-3′
IL-6 TSS:
For. 5′-AATGTGGGATTTTCCCATGA-3′, Rev. 5′-AGTTCATAGCTGGGCTCCTG-3′
TNF-α TSS:
For. 5′-ATCGGAGCAGGGAGGATG-3′, Rev. 5′-CCAGCGGAAAACTTCCTT-3′
IκB-α TSS:
For. 5′-GGAAGGACTTTCCAGCCACT-3′, Rev. 5′-GGAATTTCCAAGCCAGTCAG-3′
For the ChIP/re-ChIP experiment, the immunoprecipitated DNA–protein complex was eluted from the beads by incubating with 50 µl of 10-mM 10mM Dithiothreitol (DTT) diluted in Tris-EDTA (TE) buffer at 37ºC for 30 min. The eluted supernatant was diluted 20 times in ChIP dilution buffer from the Millipore Magna ChIP assay kit, and second round of ChIP was performed using the αPRMT6 antibody.
The primer sequences were as follows:
Intergenic region 8000 upstream IL-6 promoter:
For. 5′- GCTCCTCCATCTGGTGTCAT-3′, Rev.5′-AAATTGGGGGTAGGGTTGTC-3′
IL-6 TSS:
For. 5′-AATGTGGGATTTTCCCATGA-3′, Rev. 5′-AGTTCATAGCTGGGCTCCTG-3′
TNF-α TSS:
For. 5′-ATCGGAGCAGGGAGGATG-3′, Rev. 5′-CCAGCGGAAAACTTCCTT-3′
IκB-α TSS:
For. 5′-GGAAGGACTTTCCAGCCACT-3′, Rev. 5′-GGAATTTCCAAGCCAGTCAG-3′
For the ChIP/re-ChIP experiment, the immunoprecipitated DNA–protein complex was eluted from the beads by incubating with 50 µl of 10-mM 10mM Dithiothreitol (DTT) diluted in Tris-EDTA (TE) buffer at 37ºC for 30 min. The eluted supernatant was diluted 20 times in ChIP dilution buffer from the Millipore Magna ChIP assay kit, and second round of ChIP was performed using the αPRMT6 antibody.
5
ChIP Assay Using Magna Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the Magna ChIP assay kit (Millipore, Massachusetts, USA) according to the manual. Briefly, 1 × 107 cells were fixed with 1% formaldehyde for 10 min at room temperature. Then, 10 × glycine was added to the solution to neutralize the excess formaldehyde. Next, sonication was used to shear the DNA into 200-500-nt fragments. Antibodies targeting E2F1, hnRNPL and IgG were used for each assay. qRT-PCR was used to evaluate the enrichment of E2F1 and IgG. The primers involved in these assays are listed in the supplementary file (Table S2 ).
6
ChIP-qPCR for miR-338-3p Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using the Magna ChIP Assay Kit (Millipore) according to the manufacturer’s protocol. Quantitative analysis was carried out by real-time PCR with primers listed as follows: human miR-338-3p promoter sense, 5′-CCGTGGGTGATGCTGTCTG-3′ human miR-338-3p promoter antisense, 5′-CAGCACAGGCCTTTGTGCC-3′ human miR-338-3p upstream sense, 5′-CAGCCACCCACTCAGAGCG-3′ human miR-338-3p upstream antisense, 5′-GTGGCTCTGAGAATCTTCG-3′ mouse miR-338-3p promoter sense, 5′-CAGCGTGCAGGAGCAGATGC-3′ mouse miR-338-3p promoter antisense, 5′-GCCCTGGAAGAGTCCACGGG-3′ mouse miR-338-3p upstream sense, 5′-CAGCGTGGGAGCAGAATTCA-3′ mouse miR-338-3p upstream antisense, 5′-GCCTTTGTTG GGGGCTGCTT-3′.
7
ChIP-re-ChIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using the Magna ChIP Assay Kit (Millipore) according to the manufacturer's instructions. For re-ChIP, complexes were eluted from the primary immunoprecipitation by incubation with 10 mM DTT at 37 °C for 30 min and diluted 1:50 in re-ChIP buffer (150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8.1) followed by re-immunoprecipitation with the second antibodies. Real-time PCR was performed to detect relative occupancy. The primers used for real-time PCR are displayed as follows: FHL1 promoter forward: 5′-GATGGGGCTTATTTAGCTCCCTC-3′; FHL1 promoter reverse: 5′-CTTCGGGGCCCACGCCGTTT-3′; FHL1 upstream forward: 5′-AAGGACTTGATTACTTTGTGTGCTG-3′; FHL1 upstream reverse: 5′-AGCACGAGGAAAACGGCCTTC-3′.
8
ChIP Assay for miR-326 Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using Magna ChIP Assay kit (Catalog # 17‐371, Millipore) according to the manufacturer's instruction. Briefly, tissues or cells were fixed using 1% formaldehyde and harvested on ice with ChIP lysis buffer. Subsequently, the DNA was sonicated and the supernatant was collected and incubated with dynabeads protein G that was conjugated with anti‐SP1, anti‐HDAC1 and anti‐acetylated histone antibodies. IgG was used as negative control. ChIP‐derived DNA was quantified using qRT‐PCR with SYBR Green incorporation (Applied Biosystems). The primers specific for the miR‐326 gene promoter and GAPDH are presented below:
| hsa‐miR‐326 promoter | Forward: 5′‐CCTGGGCTCACACAATCTTT‐3′; |
| Reverse: 5′‐TCACACCTGTAATCCCAGCA‐3′; | |
| GAPDH | Forward: 5′‐TACTAGCGGTTTTACGGGCG‐3′ |
| Reverse: 5′‐TCGAACAGGAGGAGCAGAGAGCGA‐3′ |
9
ChIP Assay to Study p53 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using HepG2 cells transfected with HBx or empty vector by using Magna ChIP Assay Kit (Millipore, Billerica, MA, USA), according to the manufacturer's instructions. Protein–DNA complexes were precipitated using normal IgG and anti-p53 antibodies (Sigma-Aldrich, St. Louis, MO, USA) by overnight incubation at 4 °C in a shaker. Immunoprecipitated DNA was used for real-time PCR amplification.
10
ACER2 Regulation by p53 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHIP assays were performed using a Magna CHIP assay kit (Millipore EMD) essentially according to the manufacturer’s instructions. DNA fragments were immunoprecipitated with p53 antibody or naïve control IgG and were subjected to qPCR analyzes using the primer pairs P1 (5′-GGGTCTGTGTCAGCCCATTC-3′/5′-GCACTCCGAGAGCAGGTATT-3′), P2 (5′-CACTCCCACCAGGCAGACTT-3′/5′-AGTTGAATTAGCGGCTTGCAC-3′), P3 (5′-AGGTTCAAGGTGGTGGTCAGT-3′/5′-TGCAGTGCAAGGAACTCCCA-3′). P1, P2, and P3 amplified a DNA segment encompassing the p53 putative binding site RE1 or RE2 in the first intron of the ACER2 gene and a distal DNA segment (non-RE) in the fourth exon of the ACER2 gene (a negative control), respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!