Bj5183 cells

Construction of adenoviral constructs encoding human or mouse CD81, SCARB1, CLDN1, or OCLN was described previously (16 (link)) using the AdEasy adenoviral vector system (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s instructions. Briefly, cDNAs encoding HCV entry factors were PCR amplified and inserted into the pShuttle-CMV (CMV stands for cytomegalovirus) using KpnI/NotI sites. Recombinant pShuttle-CMV plasmids were linearized with PmeI and ligated to pAdEasy by homologous recombination followed by electroporation into BJ5183 cells (Agilent). Recombinant pShuttle-pAdEasy constructs were identified by PacI restriction analysis. All plasmid constructs were verified by DNA sequencing.

Sodium salts of FFA’s were purchased from Sigma (St. Louis, MO, USA). SCD1 (A939572) and Ire1α (4μ8c) inhibitors were from Calbiochem (EMD Millipore, Burlington, MA, USA). The processed murine SREBP1c coding sequence was amplified from liver cDNA, sub-cloned into pAdTrack-CMV, sequence verified, and incorporated into pAdEasy-1 vector via homologous recombination in BJ5183 cells (Agilent Technologies, Santa Clara, CA, USA). Total cellular lipids were extracted according to the Folch method [27 (link)] and resolved on a silica gel plate using hexane-diethyl ether-acetic acid (90:30:1) as the developing solvent. Mouse plasma PYY was measured by EIA (RayBiotech, Norcross, GA, USA) and human PYY was measured using RIA as previously described [19 (link)]. Plasma TGs were measured using the L-type triglyceride M kit (Wako Diagnostics).

For complementary alignment, the primers (FWR: 5` TCGAGGCACCTTTATATCATTATTCAAGAGATAATGATATAAAGGTGCCTTTTT-3’.
REV: 5’-GAAAAAGGCACCTTTATATCATTATCTCTTGAATAATGATATAAAGGTGCC-3’) were diluted to 100 µM in a buffer solution containing (in mM) 50 NaCl, 10 Tris–HCl, 10 MgCl₂ and 10 µg/mL BSA, pH 7.9 and incubated at 95 °C for 5 min followed by 3 h incubation at 25 °C. The shRNA was then subcloned into the pShuttleU6 vector (Addgene) using XbaI and SalI (New England Biolabs). The adenoviral vectors were generated using the AdEasy system. Briefly, homologous recombination was carried out by electroporation of BJ5183 cells (Agilent Technologies) with PmeI linearized DNA (pAD/RFP adenovirus) was used as control. Recombinant adenoviral plasmids were digested with PacI (New England Biolabs) and transfected into AdHEK293 cells with Lipofectamine 2000 (Life Technologies) according to the manufacturer’s guidelines. Following observation of cytopathic effects for 21 days, the cells were scraped and subjected to four freeze–thaw cycles in a dry-ice methanol bath. The resulting supernatant was used to infect a 10 cm dish of 70% confluent AdHEK293 cells. Following observation of CPEs after 5–7 days, viral particles were purified and expanded by infecting 4 plates of AdHEK293 cells. For specificity and efficiency see Additional file 1.