Urban dust 1649b was purchased from National Institute of Standard and Technology (NIST) (Gaithersburg, MD, USA). Diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT), TRIzol agent and gallic acid were supplied by Sigma (St Louis, MO, USA). 2′,7′-dichlorofluorescin diacetate (DCFH-DA) was purchased from Thermo-Fisher (Waltham, MA, USA).
Trizol agent
Manufactured by Merck Group
Sourced in United States
TRIzol agent is a reagent used for the isolation and purification of RNA from biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitates the separation of RNA from DNA and proteins during the extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Rr037b, by Takara Bio (2 mentions)
Rr420b, by Takara Bio (2 mentions)
Phosphor screen, by GE Healthcare (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (2 mentions)
γ 32p atp, by PerkinElmer (2 mentions)
3 4 5 dimethyl 2 thiazolyl 2 5 diphenyltetrazolium bromide, by Merck Group (1 mentions)
2 7 dichlorofluorescin diacetate dcfh da, by Thermo Fisher Scientific (1 mentions)
Gallic acid, by Merck Group (1 mentions)
Nanodrop onec spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Deoxyribonuclease 1, by Thermo Fisher Scientific (1 mentions)
Fastprep tube, by MP Biomedicals (1 mentions)
High capacity cdna rt kit, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Minimal essential media eagle mem, by Merck Group (1 mentions)
Mem non essential amino acid, by Merck Group (1 mentions)
10 protocols using trizol agent
1
Antioxidant Assessment of Urban Dust
2
Analyzing TCF4 Transcripts via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR (qPCR) was performed to analyze TCF4 transcripts level with iTaq SYBR Green Supermix. Sequences of primers were described previously.30 (link) Cells were harvested using Trizol agent (Sigma, St. Louis, MO, USA), and the TCF4 mRNA levels were analyzed by qPCR.
3
RNA Isolation and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression levels were determined in liver, kidney, spleen, and muscle tissues. Tissue was homogenized in 1 ml of TRIzol agent (Sigma-Aldrich) using FastPrep tubes (MP Biomedicals), and RNA was isolated according to the manufacturer’s instructions. FACS-sorted phagocytes were pelleted by centrifugation for 5 min at 400g and disrupted in 350 μl of RLT buffer (Qiagen RNeasy Mini Kit) using a 30-gauge needle and syringe. RNA isolation was further performed according to the manufacturer’s protocol. RNA concentration and quality were determined on the NanoDrop OneC spectrophotometer (Thermo Fisher Scientific). Subsequently, 1 μg of RNA was treated with deoxyribonuclease I (Invitrogen) and reverse-transcribed using the High Capacity cDNA RT Kit (Applied Biosystems). Because of limited material of FACS-sorted phagocytes, only 300 ng of RNA was reverse-transcribed using the High Capacity cDNA RT Kit (Applied Biosystems). Gene expression was measured on QuantStudio 5 Real-Time PCR System (Applied Biosystems) using Fast SYBR Green Master Mix (Applied Biosystems). Primer sequences are listed in Table 1 . Values were normalized to the housekeeping gene [TATA box–binding protein (Tbp) or 18S], and gene expression was expressed relative to the Ctrl group using the 2-ΔΔCt method (or relative to the TB group in case of tumor tissue).
4
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of spinal cord tissue or bEnd.3 cells were extracted using Trizol agent (Sigma, United States). Add chloroform in the ratio of Trizol: chloroform (5:1). Leave the mixture on ice for 10 min after shaking. Then centrifuge at 4 °C at 12 000 r/min for 15 min. Carefully absorb the top supernatant and transfer it to a new 1.5 mL EP tube. Add an equal amount of isopropanol to the EP tube, turn it upside down 10 times. Then centrifuge at 12 000 r/min for 15 min. Discard the supernatant and wash the RNA with 75% alcohol. Then 20 μL enzyme-free water was added and gently blown to fully dissolve the RNA. After detecting the RNA concentration using a Nanodrop (Thermo Fisher, United States), a Reverse Transcription System (Promega, United States) was used to reverse transcription of RNA into cDNA. GoTaq® qPCR Master Mix (Promega, United States) was used for real-time quantitative PCR. PCR results were analyzed by 2−ΔΔCt method. GAPDH was used as internal reference. Primers used were listed in Table S2 .
5
Regulation of TCF4 in Corneal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FECD corneal endothelial cell lines (F35T and F45SV) and a control corneal endothelial cells (W4056–17-001579) were cultured as described (26 (link)) The C9 and VVM84 skin fibroblasts were maintained at 37°C and 5% CO2 in Minimal Essential Media Eagle (MEM) (Sigma, M4655) supplemented with 15% heat inactivated fetal bovine serum (Sigma) and 0.5% MEM nonessential amino acids (Sigma).
Endothelial or fibroblast cells were seeded in 6-well plate at 90% confluence. At the next day, actinomycin D was added into the wells at 5 μg/ml final concentrations. Cells were harvest using TRIzol agent (Sigma) at different time point. The TCF4 RNA levels were analyzed by qPCR.
Endothelial or fibroblast cells were seeded in 6-well plate at 90% confluence. At the next day, actinomycin D was added into the wells at 5 μg/ml final concentrations. Cells were harvest using TRIzol agent (Sigma) at different time point. The TCF4 RNA levels were analyzed by qPCR.
6
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GelMA hydrogels were removed from the models, snap-frozen, and minced in liquid nitrogen. Total RNA of cells encapsulated within the hydrogels were extracted using TRIzol agent (T9424, Sigma-Aldrich). To characterize the gene expression profile of the native aortic medial layer, the nondiseased and TAA tissues were dissected, and the RNA of medial layer tissue was extracted using a similar approach. Synthesis of complementary DNA and qRT-PCR were performed according to standard protocols (RR037B and RR420B, Takara). The primers used in this study were listed in Supplemental Tables 2 and 3.
7
Metabolic Profiling of Diseased Vascular Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hydrogels encapsulating control and diseased HAoSMCs were planted onto the XF96 plates using a microfluidic puncher (diameter: 4 mm). Cells cultured in 2D flasks were planted according to the manufacturer's protocols. Oxygen consumption rates (OCRs) and extracellular acidification rates (ECARs) were measured using the mitochondrial stress test kit (103015-100, Agilent) with the following drug concentrations: 1.5-μM oligomycin, 2-μM FCCP and 0.5-μM rotenone + antimycin A, on the XF96 Extracellular Flux Analyzer (Seahorse Bioscience, Agilent) as previously described57 . OCRs and ECARs were normalized by the amount of the total DNA extracted using TRIzol agent (T9424, Sigma-Aldrich). Cytosolic nicotinamide adenine dinucleotide (NAD+)/nicotinamide adenine dinucleotide hydride (NADH) ratio was measured using NAD+/NADH quantification kit (S0175, Beyotime).
8
Purification and Analysis of Cmr-α complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred microliters of purified Cmr-α complexes (about 10 μg protein for each) were mixed with 600 μl Trizol agent (Sigma) and 300 μl chloroform in the indicated order. After incubation at room temperature for 5 min, the mixture was centrifuged at 12 000 rpm for 15 min. The upper phase was transferred into a new tube and precipitated by one volume of isopropanol, and RNA precipitants were recovered as a pellet by centrifugation. After washing with 1 ml of 75% ethanol pre-chilled on ice, the RNA pellet was air-dried for 30 min at room temperature, dissolved in 15 μl DEPC-H2O, and used for further analysis.
An aliquot of the purified crRNA was first 5′ labeled by 32P-γ-ATP (PerkinElmer) using T4 polynucleotide kinase (Thermo Fisher Scientific), and then separated on a large denatured polyacrylamide gel (12%, 40 cm long, containing 40% urea). The labeled RNAs were identified by exposing the gel to a phosphor screen (GE Healthcare), and scanned by using a Typhoon FLA 7000 laser scanner (GE Healthcare). RNA ladders were generated by Decade™ Marker RNA (Ambion) and labeled by 32 P with T4 polynucleotide kinase.
An aliquot of the purified crRNA was first 5′ labeled by 32P-γ-ATP (PerkinElmer) using T4 polynucleotide kinase (Thermo Fisher Scientific), and then separated on a large denatured polyacrylamide gel (12%, 40 cm long, containing 40% urea). The labeled RNAs were identified by exposing the gel to a phosphor screen (GE Healthcare), and scanned by using a Typhoon FLA 7000 laser scanner (GE Healthcare). RNA ladders were generated by Decade™ Marker RNA (Ambion) and labeled by 32 P with T4 polynucleotide kinase.
9
Extraction and Analysis of crRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The purified LdCsm complex (100 μl) was first mixed with l00 μl Trizol agent (Sigma), and then 200 μl chloroform:isoamylalcohol (24:1, v/v) was added. After vortex for 30 s, the mixture was centrifuged at 12,000 rpm for 10 min at 4 °C. The upper phase was transferred into a new tube and re-extracted with 200 μl chloroform:isoamylalcohol. crRNA in the upper phase was precipitated with one volume of isopropanol and washed twice with 1 ml of 70% ice-cold ethanol. The pellet was air-dried for 30 min at the room temperature and dissolved in 20 μl DEPC-H2O. Ten nanograms of crRNA was 5ʹ-labeled with [γ-32P]-ATP (PerkinElmer) using T4 polynucleotide kinase (New England Biolabs) and separated on a 12% denaturing polyacrylamide gel. The labeled crRNAs were identified by exposing the gel to a phosphor screen (GE Healthcare) and scanned with a Typhoon FLA 7000 (GE Healthcare). For northern blotting of crRNA, 100 ng of unlabeled crRNA was mixed with equal volume of 2× RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel. Northern blotting analysis was conducted as described previously67 (link), using radio-labeled RNA S1–40 (Supplementary Table S1 ).
10
Gene Expression Analysis in Aortic Smooth Muscle Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the primary aortic smooth muscle cells expanded from BAV patients and controls were extracted using TRIzol agent (T9424, Sigma-Aldrich). Synthesis of complementary DNA and qRT-PCR was performed according to the manufacturer’s guidelines (RR037B and RR420B, Takara). The expression levels of the following genes were investigated: ADAM10 (forward: ATGGGAGGTCAGTATGGGAATC; reverse: ACTGCTCTTTTGGCACGCT), HEY2 (forward: AAGGCGTCGGGATCGGATAA; reverse: AGAGCGTGTGCGTCAAAGTAG), NOTCH3 (forward: TGGCGACCTCACTTACGACT; reverse: CACTGGCAGTTATAGGTGTTGAC), SERPINE1 (forward: ACCGCAACGTGGTTTTCTCA; reverse: TTGAATCCCATAGCTGCTTGAAT), SUMO4 (forward: CCACGGGGATTGTCAGTGAAG; reverse: CTGTGCAGGTTTGTCTGTTCC), SVEP1 (forward: CAGCAGTTGCATTCCATGTCC; reverse: AAGTAACCATTTTCGGGAGGC), and GAPDH (forward: CTGGGCTACACTGAGCACC; reverse: AAGTGGTCGTTGAGGGCAATG).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!