Imagen reader las 1000

Kc167 cells (DGRC cat. no. 1) were maintained in SFX medium supplemented with 10% inactivated fetal bovine serum (Invitrogen, ref. #10108-165) and penicillin/streptomycin stock of antibiotics (Sigma P4333-100ML) at 25°C without CO₂. Ecdysone treatment was done by incubation with 0.5 μM 20-Hidroxyecdysone (20-HE) (Sigma H5142-10MG) in culture medium for 3 hr; vehicle control with ethanol was performed in parallel. Western analysis was performed using standard procedures. PVDF membranes were incubated with one of the following primary antibodies: polyclonal rabbit a-Psq^tot (1:2000), polyclonal rabbit a-Psq^L (1:2000), a-Actin (Sigma A2066, 1:500), rat a-Mod(mdg4)2.2 (1:2000), rabbit a-CP190 (1:2000). Proteins were detected using the chemiluminescent substrate ECL (Pierce, 32209), LAS-100 detector (FujiFilm) and Imagen Reader LAS-1000 software (FujiFilm). Transient transfection experiments were done in 6 well plates with 8 × 10⁵ cells per well in 2 mL of medium and 1 μg of total DNA per well. The amount of each plasmid was adjusted to obtain equimolar concentrations. Cells were transfected using Cellfectin II Reagent (Invitrogen 10362-100). dsRNA was generated using the Megascript T7 High Yield Transcription Kit (Ambion NC. 1404051). Primers used for the RNAi KD recognizing all isoforms of Psq are For 5′-TAATACGACTCACGCTGCCCTGCTTA-3′; Rev 5′- TAATACGACTCACAAGGCTCA CAATG-3′).