Qscript xlt cdna supermix

Manufactured by Quantabio

Sourced in United States

QScript XLT cDNA SuperMix is a ready-to-use reagent for reverse transcription and real-time PCR amplification of RNA targets. It contains all the necessary components for efficient cDNA synthesis and subsequent qPCR in a single reaction mixture.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

QScript XLT cDNA SuperMix kit QScript cDNA SuperMix QScript Supermix

38 protocols using qscript xlt cdna supermix

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was collected using a RNeasy Plus minikit (Qiagen) according to the manufacturer’s instructions and stored at −80°C until further use. The RNA concentration was determined using a NanoDrop One^C (Thermo), and 500 ng total was reverse transcribed using qScript XLT cDNA SuperMix (QuantaBio) using a combination of random and oligo(dT) primers according to the manufacturer’s instructions. cDNA was diluted 1:10 for all RT-qPCR experiments and SsoFast EvaGreen Mastermix (Bio-Rad) was used to amplify cDNA. The Cq method was used to determine the fold change in expression of target transcripts. qPCR primer sequences can be found in Table 3.

Kleer M., MacNeil G., Adam N., Pringle E.S, & Corcoran J.A. (2022). A Panel of Kaposi’s Sarcoma-Associated Herpesvirus Mutants in the Polycistronic Kaposin Locus for Precise Analysis of Individual Protein Products. Journal of Virology, 96(5), e01560-21.

+ Open protocol

+ Expand

Quantitative PCR for Xenograft RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After obtaining RNA in triplicate from xenografts as described in the microarray analysis, cDNA was created using qScript XLT cDNA Supermix (Quanta Bio), following manufacturer’s protocol. cDNA was diluted to a constant concentration for all samples to ensure similar nucleic acid loading. Quantitative PCR was carried out using Power Syber Green Master Mix (Applied Biosystems), primer sequences in Supplementary Tables S2–S4, and an Applied Biosystems StepOne Real-Time PCR cycler following Applied Biosystems Syber guidelines: 95°C for 10 min, followed by 40 cycles of 95°C/15 sec and 60°C/1 min. Ct values were calculated using StepOne software (Applied Biosystems).

Chandra A., Jahangiri A., Chen W., Nguyen A.T., Yagnik G., Pereira M.P., Jain S., Garcia J.H., Shah S.S., Wadhwa H., Joshi R.S., Weiss J., Wolf K.J., Lin J.M., Müller S., Rick J.W., Diaz A.A., Gilbert L.A., Kumar S, & Aghi M.K. (2020). Clonal ZEB1-driven mesenchymal transition promotes targetable oncologic anti-angiogenic therapy resistance. Cancer research, 80(7), 1498-1511.

+ Open protocol

+ Expand

Quantitative Real-Time RNA Transcription

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following the methods described previously [21 (link)], 200 ng of total RNA was used as template in a mastermix of qScript XLT cDNA SuperMix (Quantabio, Beverly, MA, USA), including a mix of random hexamers and oligo(dT) primers, for a total reaction volume of 20 µL as per the manufacturer’s amplification instructions.

McGregor B.L., Reister-Hendricks L.M., Nordmeyer C., Stapleton S., Davis T.M, & Drolet B.S. (2023). Using Zoos as Sentinels for Re-Emerging Arboviruses: Vector Surveillance during an Outbreak of Epizootic Hemorrhagic Disease at the Minnesota Zoo. Pathogens, 12(1), 140.

+ Open protocol

+ Expand

Quantitative RT-qPCR in Mouse Embryonic Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from MEFs was isolated using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. cDNA was obtained by reverse transcription (RT) of 1 µg RNA using qScript XLT cDNA SuperMix (QuantaBio; 95161). Ten ng of cDNA was diluted in nuclease-free water and ran in technical triplicates using PowerUp SYBR Green Master Mix (Applied Biosystems) on a QuantStudio 5 (Thermo Fisher Scientific). Tbp (TATA-box binding protein) was used as an endogenous control.
Primer sequences were:

Cuevas-Navarro A., Rodriguez-Muñoz L., Grego-Bessa J., Cheng A., Rauen K.A., Urisman A., McCormick F., Jimenez G, & Castel P. (2022). Cross-species analysis of LZTR1 loss-of-function mutants demonstrates dependency to RIT1 orthologs. eLife, 11, e76495.

+ Open protocol

+ Expand

Quantification of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Renal tissue RNA was isolated from a small piece of flash-frozen tissue using the RNeasy Plus Mini Kit (Qiagen, Germantown, MD) and cDNA was synthesized using the qScript XLT cDNA SuperMix (Quantabio, Beverly, MA). For human cell RNA, RCTE, 9–12, and HCC827 cells were treated with IFN-γ (100 ng/ml) or phosphate-buffered saline solution (control) for 24 hours prior to RNA isolation. Quantitative polymerase chain reaction was performed using the PowerSYBER PCR Master Mix (Applied Biosystems) on a CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, CA). Primer details can be found in the Supplementary Methods.

Kleczko E.K., Marsh K.H., Tyler L.C., Furgeson S.B., Bullock B.L., Altmann C.J., Miyazaki M., Gitomer B.Y., Harris P.C., Weiser-Evans M.C., Chonchol M.B., Clambey E.T., Nemenoff R.A, & Hopp K. (2018). CD8+ T cells modulate autosomal dominant polycystic kidney disease progression. Kidney international, 94(6), 1127-1140.

+ Open protocol

+ Expand

Liver RNA Isolation and OATP1B2, CYP3A11 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Livers were harvested from female CYP3A(−/−), FVB wild-type, OATP1B2(−/−), and DBA wild-type mice between 8 and 12 weeks of age. Livers were snap frozen and stored at −80 °C until RNA isolation. RNA was isolated by utilizing an E.Z.N.A. Total RNA Kit I (Omega Bio-tek, Norcross, GA, USA), followed by cDNA synthesis with qScript XLT cDNA SuperMix (Quantabio, Beverly, MA, USA). Real-time polymerase chain reaction (qPCR) was performed using TaqMan probes for OATP1B2 (Mm00451513_m1), CYP3A11 (Mm00731567_m1), and GAPDH (Mm99999915_g1) (Thermo Fisher Scientific) and a QuantStudio 3 instrument (Thermo Fisher Scientific).

Eisenmann E.D., Garrison D.A., Talebi Z., Jin Y., Silvaroli J.A., Kim J.G., Sparreboom A., Savona M.R., Mims A.S, & Baker S.D. (2022). Interaction of Antifungal Drugs with CYP3A- and OATP1B-Mediated Venetoclax Elimination. Pharmaceutics, 14(4), 694.

+ Open protocol

+ Expand

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cells using Quick RNA-miniprep (Zymo Research) and the RNA was reverse-transcribed using SuperScript® III Reverse Transcriptase with random hexamer (Invitrogen) or qScript XLT cDNA SuperMix (QuantaBio). We performed qRT-PCR in QuantStudio 3 qPCR systems (Applied Biosystems, Thermo Fisher) using 2X Ssoadvanced Universal Sybr Green Supermix (Bio-Rad). We used glyceraldehyde-3-phosphate dehydrogenase for normalization. We used a two-tailed Student’s t test to obtain the p-values. The sequences of qPCR primers are provided in Supplementary Table 2. All RT-qPCRs were performed with at least biological duplicates. Each biological replicate has three technical repeats.

Zhang Z., Lee J.H., Ruan H., Ye Y., Krakowiak J., Hu Q., Xiang Y., Gong J., Zhou B., Wang L., Lin C., Diao L., Mills G.B., Li W, & Han L. (2019). Transcriptional landscape and clinical utility of enhancer RNAs for eRNA-targeted therapy in cancer. Nature Communications, 10, 4562.

+ Open protocol

+ Expand

RNA Extraction and Quantitative PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was collected using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions and stored at -80°C until further use. RNA concentration was determined using NanoDrop One^C (ThermoFisher) and 500 ng of RNA was reverse transcribed using qScript XLT cDNA SuperMix (QuantaBio) using a combination of random hexamer and oligo dT primers, according to the manufacturer’s instructions. Depending on starting concentration, cDNA was diluted between 1:10 and 1:20 for qPCR experiments and SsoFast EvaGreen Mastermix (Biorad) was used to amplify cDNA. The ΔΔquantitation cycle (Cq) method was used to determine the fold change in expression of target transcripts using HPRT as a housekeeping control gene. Variance in the mock or empty vector samples was calculated by dividing the ΔCt value of a single replicate by the average ΔCt value of all replicates for that specific gene and condition. qPCR primer sequences can be found in Table 4.

Kleer M., Mulloy R.P., Robinson C.A., Evseev D., Bui-Marinos M.P., Castle E.L., Banerjee A., Mubareka S., Mossman K, & Corcoran J.A. (2022). Human coronaviruses disassemble processing bodies. PLoS Pathogens, 18(8), e1010724.

+ Open protocol

+ Expand

Quantifying Astrocyte GLAST Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from primary WT and nNOS^−/− cerebellar astrocyte cultures using the RNeasy Mini Kit (Qiagen, Toronto, ON) as per the manufacturer's instructions. Reverse transcription of 1 μg RNA to cDNA was performed using qScript™ XLT cDNA SuperMix (QuantaBio, Beverly, MA) following the manufacturer's instructions. Next, qPCR was performed using PerfeCTa SYBR Green FastMix for iQ (QuantaBio), along with 25 ng of cDNA template, and 500 nM of forward and reverse primers for SLC1A3, exon 3 (gene encoding GLAST): forward 5′CCTTGGATTTGCCCTCCGA3′; reverse 5′CTCCCCAGGGAACGAAAAGT3′. Reverse transcription quantitative polymerase chain reaction (RT‐qPCR) reactions were run in triplicate along with a no‐template control using a BioRad MyiQ single‐color real‐time PCR detection system (BioRad, Mississauga, ON). The difference in cycle thresholds (ΔCT) between the reference gene β‐actin (forward: 5′CTGTCCCTGTATGCCTCTG3′; reverse 5′ATGTCACGCACGTTTCC3′) and exon 3 of SLC1A3 were graphed using GraphPad Prism 8.

Tellios V., Maksoud M.J, & Lu W. (2022). The expression and function of glutamate aspartate transporters in Bergmann glia are decreased in neuronal nitric oxide synthase‐knockout mice during postnatal development. Glia, 70(5), 858-874.

+ Open protocol

+ Expand

Comprehensive RNA Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRIzol reagent (Thermo Fisher) following the manufacturer's recommendations. cDNA was synthesized using qScript cDNA supermix (Quantabio). Real-time PCR was performed using SYBR Green PCR master mix (Life Technologies) with primers listed in Supplemental Table S1. L32 was used to normalize expression. TaqMan assays (Life Technologies) for miRNA qPCR were normalized to miR-16. The 7500 Fast real-time PCR system (Applied Biosystems) were used for qPCR reactions. Low-abundance cytokines and chemokines were amplified via qPCR by using the PerfeCTa PreAmp supermix (Quantabio). cDNA was synthesized using qScript XLT cDNA supermix (Quantabio). Primers were pooled, and preamplification reactions with PerfeCTa PreAmp supermix were performed following the manufacturer's recommendations. Real-time PCR was performed using iTaq universal SYBR Green supermix (Bio-Rad) with primers listed in Supplemental Table S1. L32 was used to normalize expression. The CFX384 real-time PCR detection system (Bio-Rad) was used.

Kundu S.T., Rodriguez B.L., Gibson L.A., Warner A.N., Perez M.G., Bajaj R., Fradette J.J., Class C.A., Solis L.M., Rojas Alvarez F.R., Wistuba I.I., Diao L., Chen F., Sachdeva M., Wang J., Kirsch D.G., Creighton C.J, & Gibbons D.L. (2022). The microRNA-183/96/182 cluster inhibits lung cancer progression and metastasis by inducing an interleukin-2-mediated antitumor CD8+ cytotoxic T-cell response. Genes & Development, 36(9-10), 582-600.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!