Total RNA was extracted using TRI reagent (Euromedex) followed by RNAse free-RQ1 DNAse (Promega) and proteinase K (Sigma) treatments. 1 μg of whole cell RNA was reverse transcribed with random hexamer primers using Go Script Reverse Transcriptase kit (Promega) at 42°C for 60 min. mRNA expression was performed using the IQ Custom SYBR Green Supermix (Bio-Rad) qPCR. The relative quantification of gene expression was performed using the standard curve method with triplicates for each data point. For Northern blotting analysis, 5 µg of total RNA was fractionated by electrophoresis on a 6% polyacrylamide/7 M urea denaturing gel. Electro transferred onto a nylon membrane (Amersham Hybond-N, GE Healthcare) followed by UV crosslinking (Stratalinker). Hybridizations were carried out with 5′-end 32P-labeled-DNA oligonucleotide probes. Membranes were incubated overnight at 50°C in 5X SSPE, 5X Denhardt's, 1% SDS, 150 μg/mL yeast tRNA and washed twice in 0.1% SSPE, 0.1% SDS for 15 min at room temperature. a Typhoon Biomolecular Imager (Amersham) and visualized using Multi Gauge V3.0 software. Radioactive signals were revealed using a Typhoon Biomolecular Imager (Amersham) and visualized using Multi Gauge V3.0 software. Primers are listed in Supplementary file 4 .
Iq custom sybr green supermix
Manufactured by Bio-Rad
The IQ Custom SYBR Green Supermix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains the necessary components, including SYBR Green I dye, for the detection and quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Iq5 optical system software version 1, by Bio-Rad (2 mentions)
Iq5 real time pcr detection system, by Bio-Rad (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Typhoon biomolecular imager, by Cytiva (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Goscript reverse transcriptase kit, by Promega (1 mentions)
Tri reagent, by Euromedex (1 mentions)
Amersham hybond n, by GE Healthcare (1 mentions)
Proteinase k, by Merck Group (1 mentions)
Peqgold rnapure, by Avantor (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Qiazol, by Qiagen (1 mentions)
Beacon designer 2, by Bio-Rad (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
6 protocols using iq custom sybr green supermix
1
RNA Extraction and Expression Analysis
2
Quantitative Analysis of Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of 1*106 cells was isolated using peqGOLD RNAPure (PeqLab) according to manufacturer´s protocol. 1 μg of total RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Real-time quantitative PCR assays were performed with the iQ Custom SYBR Green Supermix (Bio-Rad) using the CFX96 system from Bio-Rad. Each amplification sample contained 20 ng of cDNA, 250 nM each of forward and reverse primers and 5 μl of 2x iQ SYBR Green Supermix. The mRNA expression was normalized to GAPDH. Following primers were used for quantitative PCR: PDK4-forward—5’-cctttggctggttttggtta-3’ ; PDK4-reverse– 5’-cctgcttgggatacaccagt-3’ ; CPT1a-forward– 5’-tcgtcacctcttctgccttt-3’ ; CPT1a-reverse– 5’-acacaccatagccgtcatca-3’ ; PLIN2-forward– 5’-aagaaaaatggcatccgttg-3’ ; PLIN2-reverse– 5’-caatttgcggctctagcttc-3’ ; PPARδ-forward– 5’-tcacacagtggcttctgctc-3’ ; PPARδ-reverse– 5’-tctacagggtggttcccatc-3’ ; Angptl4-forward– 5’-gcctatagcctgcagctcac-3’ ; Angptl4-reverse– 5’-agtactggccgttgaggttg-3’ ; GAPDH-forward– 5’-tgcaccaccaactgcttagc-3’ ; GAPDH-reverse– 5’-ggcatggactgtggtcatgag-3’ .
3
Mitochondrial DNA Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the muscle samples using standard phenol–chloroform extraction and ethanol precipitation and mtDNA copy number was analyzed by qPCR, with primers from the mtDNA gene for 12S rRNA and nuclear gene for amyloid‐beta precursor protein (APP), as previously described (Tyynismaa et al, 2012 ). mtDNA deletion analysis was done using a quantitative PCR method and the primers described in He et al (2002 ) with iQ™ Custom SYBR® Green Supermix (Bio‐Rad).
4
RT-qPCR and ChIP-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reactions were performed on a CFX96 Touch Real-Time PCR Detection System (BioRad) using iQ Custom SYBR Green Supermix (BioRad). We preformed RNA expression PCR (RT–qPCR (quantitative PCR)) and ChIP-qPCR for H3K4me3 and H3K9ac on promoters of odc1, eef1a1o, rnf146, tor1a, zic1, cdc14b, eomes, xrcc1, drosha, gdf3, t, tbx2, fastkd3, gs17 (see Supplementary Methods for primer sequences). ChIP-qPCR enrichment over background was calculated using the average of 5 negative loci.
5
qPCR Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from hNCI-H716 using Qiazol (Qiagen, Milan, Italy) according to the manufacturer's instructions. Quality and quantity of RNA were analysed using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE). The cDNA was synthesized by the iScriptTM cDNA Synthesis Kit (Bio-Rad, Milan, Italy) starting from 1 μg of total RNA. PCR primers were designed through Beacon Designer 2.0 Software and their sequences were as indicated in Table 1 .
qPCR was performed in an iQ5 real-time PCR detection system (Bio-Rad) using 2× iQ Custom Sybr Green Supermix (Bio-Rad). Values were normalized on mRNA expression of human β-actin and HPRT. Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad) based on the 2−ΔCt method [7 (link)]. The dissociation curve for each amplification was analysed to confirm absence of unspecific PCR products. Experiments were repeated three times in triplicate.
qPCR was performed in an iQ5 real-time PCR detection system (Bio-Rad) using 2× iQ Custom Sybr Green Supermix (Bio-Rad). Values were normalized on mRNA expression of human β-actin and HPRT. Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad) based on the 2−ΔCt method [7 (link)]. The dissociation curve for each amplification was analysed to confirm absence of unspecific PCR products. Experiments were repeated three times in triplicate.
6
Quantitative Real-Time PCR Analysis of MNC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from MNCs from CCS or healthy donor was performed using the RNeasy Mini Kit (Qiagen, Milan, Italy) and quantified using a NanoDrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). The cDNA was synthesized by using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Milan, Italy) starting from 1 μg of total RNA. PCR primers were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer) and GGCCAGGTGCATGTATTCCT (reverse primer); PGC1-alpha primers sequences were: CTGTGTCACCACCCAAATCCTTAT (forward primer) and TGTTCGAGAAAAGGACCTTGA (reverse primer); Sirt6 human primers sequences were: CCTCCTCCGCTTCCTGGTC (forward primer) and GTCTTACACTTGGCACATTCTTCC (reverse primer). Quantitative real-time PCR (qPCR) was performed in an iQ5 real-time PCR detection system (Bio-Rad Laboratories) using 2× iQ Custom Sybr Green Supermix (Bio-Rad Laboratories). Values were normalized on mRNA expression of human β-actin and HPRT (reference genes). Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad Laboratories) based on the 2−ΔΔCt method. The dissociation curve for each amplification was analyzed to confirm the absence of nonspecific PCR products.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!