The largest database of trusted experimental protocols

Iq sybr green supermix with opticon

Manufactured by Accurate Biology
Sourced in United States

The IQ SYBR Green Supermix with Opticon is a ready-to-use solution for real-time PCR applications. It contains SYBR Green I dye, a DNA-binding fluorescent dye, along with all the necessary components for efficient and sensitive DNA amplification and detection.

Automatically generated - may contain errors

2 protocols using iq sybr green supermix with opticon

1

Extraction and Quantification of RNA Species

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from BUMPT cells and kidneys of C57BL/6J mice was extracted using a Trizol reagent (Accurate Biology, ChangSha, China) kit [8 (link), 26 (link), 27 (link)]. Total RNA (40 ng) was reverse-transcribed using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Accurate Biology). Real-time qPCR was used to examine the expression levels of miRNA, mRNA, and lncRNA by Bio-Rad (Hercules, CA, USA) iQ SYBR Green Supermix with Opticon (Accurate Biology, ChangSha, China) per the manufacturer’s instructions. The sequences of lncRNA ENSMUST_147219 were obtained from Ensembl database and those of miR-221-5p were obtained from miRDB. We used the following primers: ENSMUST_147219: 5′-TTTCACCCGCTTT GCCAAGTCTC-3′ (forward) and 5′-ATCCCTTCCCTGTCTCCTCAACTG-3′ (reverse); miR-221-5p: 5′-GCGACCTGGCATACAATGTAGAT-3′ (forward) and 5′-AGTGCAGGGTCC GAGGTATT-3′ (reverse); IRF6: 5′-ACAAACTGCTCTTCTATGGGCTTCTG-3′ (forward) and 5′-TCCTCCTCCTCATCTTCATCCACATC-3′ (reverse); β-actin: 5′-GGCTGTATTCCCCTCCATCG-3′ (forward) and 5′-CCAGTTGGTAACAATGCCATGT-3′ (reverse); and U6: 5′-CTCGCTTCGGCAGCACA-3′ (forward) and 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). ΔCt values were used to carry out the relative quantification.
+ Open protocol
+ Expand
2

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from BUMPT cells and kidney of C57BL/6J mice was extracted using Trizol Reagent (Accurate Biology, ChangSha, China) kit. [8, 26, 27] . Total RNA (40 ng) was reverse transcribed using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Accurate Biology). Real-time qPCR was used to examine the expression of miRNA, mRNA, and lncRNA by Bio-Rad (Hercules, CA, USA) iQ SYBR Green Supermix with Opticon (Accurate Biology, ChangSha, China) according to the manufacturer's instructions.
The sequences of LncRNA ENSMUST_147219 were got from Ensembl database and miR-221-5p were obtained from miRDB. The primers used were as follows: ENSMUST_147219: 5′-TTTCACCCGCTTT GCCAAGTCTC-3′ (forward) and 5′-ATCCCTTCCCTGTCTCCTCAACTG-3′ (reverse); miR-221-5p: 5′-GCGACCTGGCATACAATGTAGAT-3′ (forward) and 5′-AGTGCAGGGTCC GAGGTATT-3′ (reverse); IRF6: ACAAACTGCTCTTCTATGGGCTTCTG(forward) TCCTCCTCCTCATCTTCATCCACATC reverse and β-actin: 5′-GGCTGTATTCCCCTCCATCG-3′ (forward) and 5′-CCAGTTGGTAACAATGCCATGT-3′ (reverse), and U6: 5′-CTCGCTTCGGCAGCACA - 3′ (forward) and 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). ΔCt values were used to carry out the relative quanti cation.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!