Iq sybr green supermix with opticon
The IQ SYBR Green Supermix with Opticon is a ready-to-use solution for real-time PCR applications. It contains SYBR Green I dye, a DNA-binding fluorescent dye, along with all the necessary components for efficient and sensitive DNA amplification and detection.
Lab products found in correlation
2 protocols using iq sybr green supermix with opticon
Extraction and Quantification of RNA Species
RNA Extraction and Gene Expression Analysis
The sequences of LncRNA ENSMUST_147219 were got from Ensembl database and miR-221-5p were obtained from miRDB. The primers used were as follows: ENSMUST_147219: 5′-TTTCACCCGCTTT GCCAAGTCTC-3′ (forward) and 5′-ATCCCTTCCCTGTCTCCTCAACTG-3′ (reverse); miR-221-5p: 5′-GCGACCTGGCATACAATGTAGAT-3′ (forward) and 5′-AGTGCAGGGTCC GAGGTATT-3′ (reverse); IRF6: ACAAACTGCTCTTCTATGGGCTTCTG(forward) TCCTCCTCCTCATCTTCATCCACATC reverse and β-actin: 5′-GGCTGTATTCCCCTCCATCG-3′ (forward) and 5′-CCAGTTGGTAACAATGCCATGT-3′ (reverse), and U6: 5′-CTCGCTTCGGCAGCACA - 3′ (forward) and 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). ΔCt values were used to carry out the relative quanti cation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!