Small interfering RNAs (siRNAs) for the specific silencing of the tumor necrosis factor-α (TNF-α) gene were designed and synthesized by QIAGEN (Germany). The TNF-α siRNA was transfected according to the HiPerFect transfection reagent handbook (QIAGEN). Briefly, 3 × 105 cells were seeded in six-well plates and transfected with complexes consisting of 5 nM TNF-α siRNA or a negative control scrambled siRNA. The MCs were incubated with the transfection complexes under normal growth conditions for 48 h.
Hiperfect transfection reagent handbook
Manufactured by Qiagen
Sourced in Germany
The HiPerFect Transfection Reagent Handbook provides instructions and guidelines for the use of the HiPerFect Transfection Reagent, a product designed for efficient transfection of a variety of cell types with low cytotoxicity.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using hiperfect transfection reagent handbook
1
Silencing TNF-α with siRNA
2
Transfecting Podocytes with PLA2R
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human PLA2R plasmid and empty vectors were purchased from Origene Company (USA). The PLA2R plasmid or empty vectors were transfected into podocytes using Lipofectamine 2000 reagent (Invitrogen, USA), according to the manufacturer's instructions.
Small interfering RNAs (siRNA) for gene-specific silencing of the PLA2R were designed and synthesised by QIAGEN (Germany). PLA2R siRNA transfection was performed according to the HiPerFect transfection reagent handbook (QIAGEN). Briefly, 3 × 105 cells were seeded in 6-well plates and transfected with complexes consisting of 5 nM PLA2R siRNA or a negative control scrambled siRNA. The podocytes were incubated with the transfection complexes under normal growth conditions for 48 h.
Small interfering RNAs (siRNA) for gene-specific silencing of the PLA2R were designed and synthesised by QIAGEN (Germany). PLA2R siRNA transfection was performed according to the HiPerFect transfection reagent handbook (QIAGEN). Briefly, 3 × 105 cells were seeded in 6-well plates and transfected with complexes consisting of 5 nM PLA2R siRNA or a negative control scrambled siRNA. The podocytes were incubated with the transfection complexes under normal growth conditions for 48 h.
3
IQGAP1 Knockdown in Podocytes
4
Silencing SKP2 Using siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNAs (siRNAs) targeting SKP2 were purchased from Qiagen. For transient expression, the cell lines were transfected using HiPerFect Transfection Reagent (Qiagen), as outlined in the HiPerFect Transfection Reagent Handbook (Fifth edition, Qiagen). AllStars Negative siRNA AF 488 (Qiagen) was used both as a negative control and to determine the transfection efficiency. Two independent experiments were performed. SKP2 siRNA data: the target sequence is 5′-AAGTGATAGTCATGCTAAA-3′, the sense strand is 5′-GUGAUAGUGUCAUGCUAAATT-3′ and the antisense strand is 5′-UUUAGCAUGACACUAUCACTT-3′.
5
Dab1 siRNA Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dab1 siRNA transfection was carried out according to the HiPerFect Transfection Reagent Handbook (QIAGEN, Germany). Four Dab1 siRNAs (siRNA sequences: si1 AAGGGAGAACACAAACAGAAA, si3 CAGCGAAGCCACTTTGATAAA, si4 CACTTTGATAAAGAGGTTTAA) were designed and synthesized by QIAGEN (Germany). Briefly, 2 × 105 cells were seeded in a 6-well plate and then transfected with a 100 μL mixture containing 150 ng Dab1 siRNA (or a negative control with scrambled siRNA) and 12 μL of HiPerFect transfection reagent for 48 h.
6
Podocyte Transfection with c-Abl and Nephrin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transfection of the podocytes with c-Abl siRNA (QIAGEN, Hilden, Germany) was performed according to the HiPerFect Transfection Reagent Handbook (QIAGEN). Briefly, 2 × 105 cells were seeded in a six-well plate and transfected with the complexes containing 10 nM c-Abl siRNA (or a negative control with scrambled siRNA) and 15 μl of HiPerFect transfection reagent under normal growth conditions for 24 h.
pcDNA3.1-mNPHS1 was kindly provided by L. B. Holzman (University of Michigan, Ann Arbor, MI). pcDNA3-Abl-His6-FLAG was a gift from Benjamin Turk (Addgene plasmid #52684). The transfection of the c-Abl/nephrin plasmid was performed using the X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Briefly, 2 × 105 cells were seeded in a six-well plate and transfected with the complexes containing 2 μg of either c-Abl or nephrin plasmid (or a negative control with pcDNA3.1/pcDNA3) and 6 μl of the X-tremeGENE transfection reagent under normal growth conditions for 72 h. G418 (Sigma-Aldrich) was used to select the stably transfected cell lines.
pcDNA3.1-mNPHS1 was kindly provided by L. B. Holzman (University of Michigan, Ann Arbor, MI). pcDNA3-Abl-His6-FLAG was a gift from Benjamin Turk (Addgene plasmid #52684). The transfection of the c-Abl/nephrin plasmid was performed using the X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Briefly, 2 × 105 cells were seeded in a six-well plate and transfected with the complexes containing 2 μg of either c-Abl or nephrin plasmid (or a negative control with pcDNA3.1/pcDNA3) and 6 μl of the X-tremeGENE transfection reagent under normal growth conditions for 72 h. G418 (Sigma-Aldrich) was used to select the stably transfected cell lines.
7
Transfection and Overexpression Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA (QIAGEN) and the HiPerFect Transfection Reagent Handbook (QIAGEN) were used for cell transfection as previously described.6 The ROCK1 siRNA sequence was designed according to previous reports.5 For the overexpression of Sirt6, podocytes were transfected with a mixture containing 2 μg Sirt6 plasmids or pcDNA3.1 and 2 μl X‐tremeGENE HP DNA Transfection Reagent (Roche). Subsequently, cells were exposed to different conditions as indicated.4
8
Overexpression of Sirt3 and SRV2 in BV-2 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV-2 cells were transfected with Sirt3 and SRV2 adenovirus (Shanghai Gene-Pharma Co., Shanghai, China) according to the HiPerFect Transfection Reagent Handbook (QIAGEN). Briefly, BV-2 cells were washed with PBS after treatment and then infected with Sirt3 and/or SRV2 adenovirus for 48h using Lipofectamine 2000 (Invitrogen, 11668027) according to the manufacturer's specifications [69 (link)]. Subsequently, cells were isolated and overexpression efficiency was confirmed via qPCR.
9
Itga8 Gene Silencing in Rat Mesangial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene silencing of Itga8 was achieved by transfection of rat MC with Itga8 siRNA (si Itga8) according to the "fast protocol" from the HiPerFect Transfection Reagent Handbook (Qiagen, Hilden, Germany). MC were transfected in cell suspension with a final concentration of 5nM si Itga8 (sense: GAC CUC CUC AGG AUG AAA UdT dT, antisense: AUU UCA UCC UGA GGA GGU CdT dT, Qiagen) before seeding to allow silencing for 72 hours. A nonsilencing siRNA (si co) (sense: UUC UCC GAA CGU GUC ACG UdT dT, antisense: ACG UGA CAC GUU CGG AGA AdTdT, Qiagen) was used as control. To control for effective silencing, real-time PCR for Itga8 expression levels was performed, as described in [26] . Moreover, western blot analysis was used to confirm down regulation of Itga8 on protein level.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!