Anti gr 1 pe

Manufactured by BioLegend

Sourced in United States

Anti-Gr-1-PE is a fluorochrome-conjugated antibody that binds to the Gr-1 antigen, which is expressed on the surface of granulocytes and monocytes. This product can be used for the identification and enumeration of these cell types in flow cytometry applications.

Automatically generated - may contain errors

Lab products found in correlation

Anti cd11b fitc, by BioLegend (3 mentions) Anti mac 1 apc, by BioLegend (3 mentions) Anti b220 pe, by BioLegend (2 mentions) Anti cd3 apc, by BioLegend (2 mentions) Anti cd11b apc, by BioLegend (1 mentions) Anti cd4 fitc, by Thermo Fisher Scientific (1 mentions) Anti cd45 pe cy7, by BioLegend (1 mentions) Anti ifn γ pe, by BioLegend (1 mentions) Anti cd3 pe cy7, by BioLegend (1 mentions) Fitc anti cd107a, by BioLegend (1 mentions) Accuri c6 plus, by BD (1 mentions) Fixation permeabilization solution, by Thermo Fisher Scientific (1 mentions) Anti cd137 apc, by BioLegend (1 mentions) Axiocam mrm digital camera, by Zeiss (1 mentions) Colibri 2, by Zeiss (1 mentions) Intenslight c hgfie, by Nikon (1 mentions) Facscalibur, by BD (1 mentions) Bz 9000 microscope, by Keyence (1 mentions) Annexin 5 apc, by BioLegend (1 mentions) Giemsa, by Merck Group (1 mentions)

Spelling variants of this product

Gr-1-PE (27 citations) PE anti-mouse Gr-1 (3 citations) Anti-Gr-1-PE (clone RB6-8C5, (2 citations) PE anti-mouse Gr-1 (clone RB6-8C5), (2 citations) PE/Cy7-anti-Gr-1 mAb (clone RB6-8C5, (2 citations) PE-Cy7-anti Gr-1 antibodies (2 citations) PE-Cy5-labeled-anti-Gr-1 (2 citations)

8 protocols using anti gr 1 pe

Quantification of Myeloid-Derived Suppressor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Erythrocyte-free single cell suspensions from the spleen and tumor were incubated with anti-CD11b-APC (Biolegend, USA) and anti-Gr-1-PE (Biolegend, USA) antibodies at 4°C for 15 min in dark. After washed in buffer and centrifuged, the cell precipitation was resuspended. The percentage of CD11b⁺ Gr-1⁺ double-positive MDSCs was analyzed by flow cytometry (Beckman Coulter, Pasadena, CA, USA). To determine the CXCR4-positive expression rate in the CD11b⁺ Gr-1⁺ MDSCs group, normal mice were divided into two groups, which were treated with exosomes and PBS, respectively. The single cell suspension from the bone marrow and spleen of two groups were stained by anti-CD11b-FITC (Biolegend, USA), anti-Gr-1-PE (Biolegend, USA), and anti-CD184-APC (Biolegend, USA) antibodies and then analyzed by flow cytometry.

Li N., Wang Y., Xu H., Wang H., Gao Y, & Zhang Y. (2021). Exosomes Derived from RM-1 Cells Promote the Recruitment of MDSCs into Tumor Microenvironment by Upregulating CXCR4 via TLR2/NF-κB Pathway. Journal of Oncology, 2021, 5584406.

+ Open protocol

+ Expand

Activated T cell Immunophenotyping in Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Adequate single cells were isolated from the spleen, peripheral blood, colon adjacent tissues, and adenoma tissues of mice. These cells were incubated with the appropriate surface antibodies: anti-CD45-PE/Cy7 (Biolegend, Cat# 103113), anti-CD3-PE/Cy7 (Biolegend, Cat# 100219), anti-CD4-FITC (Invitrogen, 11-0041-85), anti-CD8a-APC (Invitrogen, 47-0081-82), anti-CD11b-FITC (Biolegend, Cat# 101206), anti-Gr-1-PE (Biolegend, Cat# 108408), anti-CD107a-FITC (Biolegend, Cat# 121605), and anti-CD137-APC (Biolegend, Cat# 106109). For intracellular staining, cells were treated with the Fixation/Permeabilization solution (Invitrogen, 00-5223-56) overnight at 4 °C before incubating with intracellular antibodies: anti-IFNγ-PE (Biolegend, Cat# 163503). CD4⁺ T cells were defined as CD45⁺CD4⁺CD8a⁻; CD8⁺ T cells were defined as CD45⁺CD4⁻CD8a⁺; activated CD4⁺ T cells were defined as CD3⁺CD4⁺CD137⁺IFNγ⁺; and activated CD8⁺ T cells were defined as CD3⁺CD8a⁺CD107a⁺IFNγ⁺ [23 (link),24 (link)]. Data acquisition was performed on an Accuri C6 Plus and analyzed using FlowJo (RRID:SCR_008520).

Guo B., Zheng Y., Fan Y., Yang Y., Wang Y., Qin L., An Y., Xu X., Zhang X., Sun G., Dou H., Shao C., Gong Y., Jiang B, & Hu H. (2024). Enhanced ApcMin/+ adenoma formation after epithelial CUL4B deletion by recruitment of myeloid-derived suppressor cells. Neoplasia (New York, N.Y.), 53, 101005.

+ Open protocol

+ Expand

Intravital Microscopy of Inflammatory Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were stimulated by injecting 10 g/kg tumor necrosis factor alpha (TNFα) i.p. 4 h prior to intravital microscopy. Following ketamine (100 mg/kg) and xylazine (100 mg/kg) anesthesia and rhodamine injection (i.p.), we exposed the mesenteric venules and recorded up to 12 30 s clips per mouse.
Rhodamine intravital microscopy was performed with a Axiotech vario 100 HD microscope, a AxioCam Mrm digital camera, and Colibri 2 light source (all Zeiss, Oberkochen, Germany).
For two-color intravital microscopy, mice were injected intravenously with X488/anti-GPIbβ (emfret Analytics, Eibelstadt, Germany) to label platelets and with anti-Gr1-PE (Bio Legend) to label neutrophils and classical monocytes 15 min prior to image recording. Analysis was performed with a Nikon^® FN-S2N fluorescence microscope, Hamamatsu Orca-05G digital camera and Nikon Intenslight C-HGFIE.

Starz C., Härdtner C., Mauler M., Dufner B., Hoppe N., Krebs K., Ehlert C.A., Merz J., Heidt T., Stachon P., Wolf D., Bode C., von zur Muehlen C., Rottbauer W., Gawaz M., Duerschmied D., Leuschner F., Borst O., Westermann D, & Hilgendorf I. (2022). Elevated platelet–leukocyte complexes are associated with, but dispensable for myocardial ischemia–reperfusion injury. Basic Research in Cardiology, 117(1), 61.

+ Open protocol

+ Expand

Characterization of Myeloid Cell Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The percentage of viable cells was determined using Annexin-V-APC (BioLegend, San Diego, CA, USA), while expression of cell surface markers was measured by staining cells with anti-c-kit-PE-Cy7, anti-Gr-1-PE and anti-Mac-1-APC (all from BioLegend) according to the manufacturer’s protocol followed by flow cytometry analysis on a FACS Calibur (Becton Dickinson, San Diego, CA, USA). FACS data were analyzed with FlowJo Software (Version X for Windows, FloJo LLC, Ashland, OR, USA).
Monitoring of cellular morphology (Figure 1b) was performed on cytospins from cultures of progenitors or day 4 differentiated HoxB8 cells as well as from freshly isolated primary mouse or human neutrophils. Cytospin slides were incubated with Giemsa (Sigma-Aldrich) solution after methanol fixation (Sigma-Aldrich). Analysis by brightfield microscopy was performed using a Keyence BZ9000 microscope at a magnification of 40× (Keyence, Itasca, IL, USA).

Sochalska M., Stańczyk M.B., Użarowska M., Zubrzycka N., Kirschnek S., Grabiec A.M., Kantyka T, & Potempa J. (2020). Application of the In Vitro HoxB8 Model System to Characterize the Contributions of Neutrophil–LPS Interaction to Periodontal Disease. Pathogens, 9(7), 530.

+ Open protocol

+ Expand

Antibody and Primer Reagents for Flow Cytometry

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.

Kang X., Cui C., Wang C., Wu G., Chen H., Lu Z., Chen X., Wang L., Huang J., Geng H., Zhao M., Chen Z., Müschen M., Wang H.Y, & Zhang C.C. (2018). CAMKs support development of acute myeloid leukemia. Journal of Hematology & Oncology, 11, 30.

+ Open protocol

+ Expand

Multimodal Immune Profiling of AML

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed flow cytometry, immunohistochemistry, and cytospin as described previously [1 (link), 15 (link), 16 (link)]. For flow cytometry analysis of AML cells, peripheral blood or BM cells were stained with anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, anti-B220-PE, or anti-Kit-PE monoclonal antibodies (BioLegend). For analysis of apoptosis, indicated AML cells were stained with PE-conjugated anti-annexin V and 7-AAD (BD Pharmingen) according to the manufacturer’s instructions.

+ Open protocol

+ Expand

Gr1 and CD11b Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following monoclonal antibodies were used: anti-Gr1-PE (phycoerythrin) (clone: RB6-8C5, BioLegend, San Diego, CA, USA) and anti-CD11b-FITC (clone: M1/70, BioLegend). Approximately 1 × 10⁶ cells were suspended in FACS buffer (PBS containing 1% bovine serum albumin and 2 mM EDTA). Cells were incubated with fluorophore-conjugated antibodies in the dark at 4 °C for 30 min, washed, and then stained with LIVE/DEAD™ Fixable Far Red dye (Invitrogen, Eugene, OR, USA) following the manufacturer’s protocol. Flow analyses were performed using a FACS Calibur system (Becton Dickinson Immunocytometry Systems, San Jose, CA, USA). IgG-PE and IgG-FITC (BioLegend) were used to distinguish specific stained population. FlowJo V10 software (FlowJo, LLC, Ashland, OR, USA) was used to quantify the percentages of positive events.

Barnett J.D., Jin J., Penet M.F., Kobayashi H, & Bhujwalla Z.M. (2022). Phototheranostics of Splenic Myeloid-Derived Suppressor Cells and Its Impact on Spleen Metabolism in Tumor-Bearing Mice. Cancers, 14(15), 3578.

+ Open protocol

+ Expand

Multi-panel Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were analyzed for GFP, PD-1, CD11b, and Gr1 expression by multichannel flow cytometry. Cells were incubated with FcR blocking reagent (Miltenyi, Bergisch Gladbach, Germany) for 10 min at room temperature. Subsequently, cells were incubated with the anti-PD-1-APC (eBioscience, San Diego, CA), anti-CD11b-APC-Cy7 (BioLegend, San Diego, CA) and anti-Gr1-PE (BioLegend, San Diego, CA) or isotype control. The cells were analyzed using FACS Aria (BD Biosciences, San Jose, CA). Kaluza software (Beckman Coulter, Brea, CA) was used to analyze the obtained data.
The expression of IFN-γ was analyzed by intracellular flow cytometry. Cells were pulsed with GolgiStop (1 μg/ml; BD Pharmingen) for 4–6 h at 37 °C before analysis. Cells were next harvested and labeled with CD4-PB and CD8-FITC. Cells were then permeabilized by incubation in Cyto-fix/Cytoperm plus (BD Pharmingen) containing formaldehyde and saponin for 30 min at 4 °C, washed twice in Perm/Wash solution, and incubated with PE-conjugated IFN-γ (Invitrogen, Camarillo, CA), or a matched isotype control for 30 min. Cells were washed in 1 × Perm/Wash solution prior to analysis.

Nahas M.R., Stroopinsky D., Rosenblatt J., Cole L., Pyzer A.R., Anastasiadou E., Sergeeva A., Ephraim A., Washington A., Orr S., McMasters M., Weinstock M., Jain S., Leaf R.K., Ghiasuddin H., Rahimian M., Liegel J., Molldrem J.J., Slack F, & Avigan D. (2019). Hypomethylating agent alters the immune microenvironment in AML and enhances the immunogenicity of a DC/AML vaccine. British journal of haematology, 185(4), 679-690.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!