Rna lipid tissue mini kit

Total RNA was isolated from the paws using the RNA Lipid Tissue Mini Kit (Qiagen, Hilden, Germany). The Quantitect kit (Qiagen) was used for removal of DNA contaminations and subsequent reverse transcription according to the manufacturer’s protocol. Real-time RT-PCR analysis was performed using the QuantiFast PCR Kit (Qiagen) and the I-Cycler IQ5™ detection system (Bio-Rad, Munich, Germany). The following mouse gene-specific primers were used for amplification: Il6 (152 base pairs (bp); NM_031168.1) forward 5′-CCTCTCTGCAAGAGACTTCCATCGA-3′, reverse 5′-AGCCTCCGACTTGTGAAGTGGT-3′; Cxcl2 (146 bp; NM_009140.2) forward 5′-GCGCCCAGACAGAAGTCATAGCC-3′, reverse 5′-CAGCAGCCCAGGCTCCTCCT-3′; Rankl (86 bp; NM_011613.3) forward 5′-AAGCCTTTCAGGGGGCCGTG-3′, reverse 5′-GCCTTCCATCATAGCTGGAGCTCCT-3′; CtsK (81 bp; NM_007802.3) forward 5′-CAGAGTGGGAAGGCAGGGTCCC-3′, reverse 5′-ACTGGCCCTGGTTCTTGACTGGA-3′; Mmp13 (125 bp; NM_008607.2) forward 5′-AGGACCCAGGAGCCCTGATGTT-3′, reverse 5′-AGGGTTGGGGTCTTCATCGCCTG, β-actin (165 bp; NM_007393.3) forward 5′-TGTTACCAACTGGGACGACA-3′, reverse 5′-GGGGTGTTGAAGGTCTCAAA-3′.
Standard and melt curves were performed to determine PCR efficiency and specificity of amplification, respectively. Mean cycle thresholds (CT) values were normalized to the reference gene β-actin (dCT).

The total RNA was extracted from liver tissues of experimental samples using Trizol reagent and RNA lipid tissue mini kit (Qiagen, Valencia, CA, USA) and the quality was determined by an Agilent 2100 bio-analyzer (Agilent technologies, Amstelveen, Netherlands). RNA was quantified using an ND-2000 spectrophotometer (Thermo Inc., Waltham, MA, USA).

The total RNA was extracted from adipocytes using RNA lipid tissue mini kit according to the manufacturer's instructions (Qiagen, Valencia, CA, USA). The extracted RNA was measured by UVS-99 micro volume UV/Vis Spectrophotometer-ACT Gene. One µg RNA was reverse transcribed using oligo (dT) and III reverse transcriptase (superscript III first stand synthesis system for RT-PCR) (Invitrogen). Real-time RT-PCR was carried out using an ABI 7500 PCR Systems (Applied Biosystems, Foster City, CA, USA). Target cDNA levels were determined by SYBR green-based real-time PCR in 20 µl reaction buffer containing 1 µl Power SYBR Green Master Mix (Applied Bio-systems), 400 µM forward (F) and reverse primers (R), and 10 ng cDNA. All PCR reactions were performed at least in triplicates, and the expression levels were normalized to the housekeeping gene β-actin in the same reaction. The primers used were follows: gtgctccagaagatgacagac (F) and ggtgggactttcctgctaa (R) for PPARγ2; gcaggaggaagatacaggaag (F) and acagactcaaatcccaaca (R) for C/EBP-α; ccgttctcttcacctacgac (F) and tccccatccccatacac (R) for adiponectin; tgtgtgatgcctttgtgg (F) and tgtgtgatgccttgtgg (R) for aP2; cccacagaaggtgattgaac (F) and ggtggagatgatgacccttt (R) for GLUT-4; cccagcccataagagttaca (F) and atcgggaagtcagcacaa (R) for FAS; and gaagtggtggagagacgcttac (F) and tatcctcaaagggctggactg (R) for SREBP-1.