E gel ex agarose gel

Manufactured by Thermo Fisher Scientific

Sourced in United States

E-Gel EX agarose gels are a pre-cast electrophoresis system designed for the separation and analysis of nucleic acid samples. The gels provide a consistent, reliable, and efficient platform for DNA and RNA separation and visualization.

Automatically generated - may contain errors

Lab products found in correlation

31 protocols using e gel ex agarose gel

Targeted DNA Sequencing for Variant Detection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The appropriate gene exons containing the variants of interest were PCR amplified as follows: 1 × FastStart PCR buffer, 1 × GC-rich solution, 2 mM magnesium chloride, 0.8 µM each of the forward and reverse primer, 0.4 mM deoxynucleoside triphosphate (dNTP), 0.04 U FastStart Taq DNA Polymerase (Roche, Basel, Switzerland), and 50 ng of gDNA. The following cycling conditions were used: 95 °C for 4 min, 35 cycles of 94 °C for 45 s, 60 °C for 30 s, 72 °C for 2 min 45 s, and a final extension at 72 °C for 10 min. The PCR amplicons were visualised by electrophoresis in 2% E-gel^™ EX Agarose Gels (Life Technologies, Camarillo, CA, USA). Bi-directional DNA sequencing was performed using BigDye^™ Terminator v3.1 Cycle Sequencing (Applied Biosystems^™ Ltd., Foster City, CA, USA). The sequenced products were purified using the BigDye XTerminator^™ Purification Kit (Applied Biosystems^™ Ltd.), and then were subjected to capillary electrophoresis using an Applied Biosystems^™ model 3500xL Genetic Analyzer. The analysis of sequence traces was performed using Variant Reporter^® Software v2.0 (ThermoFisher Scientific, Cambridge, MA, USA) and Geneious v7.1.7 software (Biomatters, Auckland, New Zealand) [44 (link)].

Leong I.U., Stuckey A., Belluoccio D., Fan V., Skinner J.R., Prosser D.O, & Love D.R. (2017). Massively Parallel Sequencing of Genes Implicated in Heritable Cardiac Disorders: A Strategy for a Small Diagnostic Laboratory. Medical Sciences, 5(4), 22.

+ Open protocol

+ Expand

Plasmid Purification and Transfection Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA plasmids were propagated in Stbl3 cells (Life Technologies). Plasmids were purified by endotoxin-free midiprep kit (Macherey-Nagel). DMEM, penicillin-streptomycin, Glutamax, OPTIMEM, Lipofectamine 2000, E-Gel EX Agarose Gels, and Dynabeads MyOne Streptavidin C1 were purchased from Life Technologies. Additional reagents: Herculase II Phusion Polymerase (Agilent), Maxima reverse transcriptase and RNaseA (Thermo-Fisher), Betaine and Fetal bovine serum (FBS) (Sigma), TURBO DNase (Ambion), Second Strand Synthesis Module (NEB), RLT lysis buffer (Qiagen), Agencourt AMPure XP (Beckman Coulter), and Zymoclean Gel DNA Recovery Kit (Zymo Research), In-Fusion (Clontech), Amicon Ultra-15 Centrifugal Filter (EMD-Millipore), Steadylite Plus (PerkinElmer), PEG-8000 (Sigma), Nextera and NexteraXT (Illumina), 50-cycle MiSeq and 75-cycle NextSeq (Illumina).

O'Connell D.J., Kolde R., Sooknah M., Graham D.B., Sundberg T.B., Latorre I., Mikkelsen T.S, & Xavier R.J. (2016). Simultaneous Pathway Activity Inference and Gene Expression Analysis Using RNA Sequencing. Cell systems, 2(5), 323-334.

+ Open protocol

+ Expand

Microglia ATAC-seq library generation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATAC-sequencing libraries were generated using Nextera^® DNA Sample Preparation Kit (Illumina, FC-121-1030) following the methods described by [66 (link), 67 ]. A total number of 80,000 microglia were pooled from two animals (40,000 cells from each) and collected in Eppendorf tubes containing 300 µL medium A. Cells were pelleted by centrifugation (10 min, 4 °C, 500×g), resuspended in 50 μL of cold lysis buffer (10 mM Tris–HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl₂, 0.1% IGEPAL CA-630) and immediately centrifuged as before. Next, nuclei were resuspended in 50 μL transposition reaction mix (1 × TD reaction buffer, 2.5 μL TN5 transposase) and incubated at 37 °C for 30 min. Immediately following transposition, the DNA was purified using a minElute PCR purification kit (Qiagen, 28004) following the manufacturer’s instructions. The transposed DNA fragments were further amplified and barcoded [66 (link), 67 ] and purified with a ChIP DNA Clean and Concentrator kit (Zymo, D5205). The fragments were run on 2% E-Gel™ EX agarose gels (Thermo Fisher scientific, G521802) and 150–600 bp fragments were excised, followed by purification with Zymoclean™ Gel DNA Recovery Kit (Zymo, D4007). Library concentration was determined with an Agilent 2100 Bioanalyzer after which 8 samples were pooled and sequenced using HiSeq Rapid SBS Kit v2 (50 cycles) using paired end reads on a HiSeq2500 (Illumina).

Zhang X., Kracht L., Lerario A.M., Dubbelaar M.L., Brouwer N., Wesseling E.M., Boddeke E.W., Eggen B.J, & Kooistra S.M. (2022). Epigenetic regulation of innate immune memory in microglia. Journal of Neuroinflammation, 19, 111.

+ Open protocol

+ Expand

Customizable CRISPR-Cas9 Genome Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the oligonucleotide sequences are shown in Supplementary Table S1. DNA sequences were obtained from Sangon Biotech (Shanghai, China). RNA oligonucleotides were synthesized by Generay Biotech (Shanghai, China). An sgRNA in vitro transcription kit and SpCas9 and dCas9 proteins were obtained from Inovogen Tech. Co. Ltd (Beijing, China). RNase inhibitor, Dzup genomic DNA isolation reagent, High-Fidelity PCR Master Mix and a SanPrep column polymerase chain reaction (PCR) product purification kit were purchased from Sangon Biotech (Shanghai, China). 4,4′-Dihydroxyazobenzene and 1-(2-chloroethyl) piperidine hydrochloride were obtained from Aladdin Biochemical Tech Co., Ltd (Shanghai, China). Lipofectamine 3000 transfection agent and E-Gel EX agarose gels were purchased from Thermo Fisher Scientific Inc. (MA, USA). The pSLQ1658-dCas9-EGFP plasmid was obtained from Addgene. A T7 endonuclease I kit was purchased from Vazyme (Nanjing, China). The concentration of nucleic acids was quantified using a NanoDrop 2000c (Thermo Scientific, MA, USA).

Deng H., Xu H., Wang Y., Jia R., Ma X., Feng Y, & Chen H. (2023). G-quadruplex-based CRISPR photoswitch for spatiotemporal control of genomic modulation. Nucleic Acids Research, 51(8), 4064-4077.

+ Open protocol

+ Expand

Bisulfite-Seq Analysis of VRK2 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen 69505). DNA was bisulfite-converted using an EpiTect Bisulfite Kit (Qiagen 59104). Bisulfite-converted DNA was PCR-amplified with the EpiMark HotStart Taq (New England Biolabs M0490) using the following primers: VRK2 TSS primer set: forward 5′-TAGGTTGTGGTATAGGAGATTTAATATT-3′, reverse 5′-AATAAAAACTATATTACTACCTCCACCC-3′. PCR was performed at an annealing temperature of 59°C for 40 cycles. PCR products were visualized on 2% E-Gel EX agarose gels (Thermo Fisher Scientific, catalog G401002) for correct size and band patterning. PCR products were then column-purified using the QIAquick PCR Purification Kit and submitted for difficult template Sanger sequencing with Azenta with both the forward and reverse primers.

So J., Mabe N.W., Englinger B., Chow K.H., Moyer S.M., Yerrum S., Trissal M.C., Marques J.G., Kwon J.J., Shim B., Pal S., Panditharatna E., Quinn T., Schaefer D.A., Jeong D., Mayhew D.L., Hwang J., Beroukhim R., Ligon K.L., Stegmaier K., Filbin M.G, & Hahn W.C. (2022). VRK1 as a synthetic lethal target in VRK2 promoter–methylated cancers of the nervous system. JCI Insight, 7(19), e158755.

+ Open protocol

+ Expand

Omni-ATAC-seq Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATAC-seq was performed using the Omni-ATAC protocol⁶⁴. For each sample, 5 × 10⁴ to 6 × 10⁴ cells were lysed with buffer containing 0.1% NP-40, 0.1% Tween-20, and 0.01% digitonin, then the lysate was washed and incubated with Tagment DNA TDE1 Enzyme (Illumina) for 30 min at 37°C. DNA was purified with a Qiagen MinElute PCR Purification Kit. Library fragments were amplified using NEBNext^® High-Fidelity 2X PCR Master Mix (NEB, M0541) and custom primers (Supplementary Table 7b) with unique dual indexes. PCR amplification cycles were in accordance with the manufacturer’s instructions. PCR products were purified using AMPure XP beads (Beckman Coulter, A63881) at a 1:1 ratio according to the manufacturer’s instructions. Purified PCR products sized from 150 bp to 1 kb were purified from 2% E-Gel EX agarose gels (Thermo Fisher, G401002). Libraries were pooled and sequenced in paired-end mode by using an Illumina HiSeq kit. Raw reads were trimmed to remove the Tn5 adaptor sequence by using skewer (version 0.2.2) then mapped to hg19 by using BWA-MEM (version 0.7.16a). Duplicated multi-mapped reads were removed with SAMtools (version 0.17). ATAC-seq peaks were called using MACS2 (version 2.1.1) with the following parameters: macs2 callpeak –nomodel –shift –100 –extsize 200. BigWiggle files were generated using DeepTools (version 3.2.0).

Feng R., Mayuranathan T., Huang P., Doerfler P.A., Li Y., Yao Y., Zhang J., Palmer L.E., Mayberry K., Christakopoulos G.E., Xu P., Li C., Cheng Y., Blobel G.A., Simon M.C, & Weiss M.J. (2022). Activation of γ-globin expression by hypoxia-inducible factor 1α. Nature, 610(7933), 783-790.

+ Open protocol

+ Expand

HTT Gene PCR Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HTT region was PCR amplified using the forward (HD1F: 5′ CCGCTCAGGTTCTGCTTTTA 3′) and reverse (HD1FR 5′ GGCTGAGGCAGCAGCGGCTG 3′) primers with the following PCR components: 10ng genomic DNA, 2μl 10x PCR Buffer, 0.25μl Taq Polymerase, 0.4μl 10mM dNTP mix, 4μl Q Solution (Qiagen), 0.8μl 5uM forward primer, 0.8μl 5uM reverse primer, and water to a final reaction volume of 20μl. Thermocycling conditions are listed in Table S3. Amplified PCR products were assessed on 2% E-Gel EX Agarose Gels (Thermo Fisher) before cloning into the pCR4-TOPO TA vector supplied in the TOPO TA Cloning® Kits for Sequencing (Thermo Fisher). Cloning and the bacterial transformation were performed according to the manufacturer’s protocol. Colonies were picked, grown overnight, and plasmid was extracted using the QIAprep Spin Miniprep Kit (Qiagen). Plasmid with TA-cloned inserts were Sanger sequenced using the universal M13 forward primer.

Dewan R., Chia R., Ding J., Hickman R.A., Stein T.D., Abramzon Y., Ahmed S., Sabir M.S., Portley M.K., Tucci A., Ibáñez K., S.h.a.n.k.a.r.a.c.h.a.r.y.a., Keagle P., Rossi G., Caroppo P., Tagliavini F., Waldo M.L., Johansson P.M., Nilsson C.F., Rowe J.B., Benussi L., Binetti G., Ghidoni R., Jabbari E., Viollet C., Glass J.D., Singleton A.B., Silani V., Ross O.A., Ryten M., Torkamani A., Tanaka T., Ferrucci L., Resnick S.M., Pickering-Brown S., Brady C.B., Kowal N., Hardy J.A., Van Deerlin V., Vonsattel J.P., Harms M.B., Morris H.R., Ferrari R., Landers J.E., Chiò A., Gibbs J.R., Dalgard C.L., Scholz S.W, & Traynor B.J. (2020). Pathogenic Huntingtin Repeat Expansions in Patients with Frontotemporal Dementia and Amyotrophic Lateral Sclerosis. Neuron, 109(3), 448-460.e4.

+ Open protocol

+ Expand

High-throughput sequencing of DEL samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Barcodes of a DEL sample (input or eluted after screening) were PCR amplified using 3 µL i5 index primer (10 µM stock in water), 3 µL i7 index primer (10 µM stock in water), 19 µL cleaned up elution samples, and 25 µL Invitrogen Platinum™ Hot Start PCR Master Mix (2×) (Invitrogen 13000012). The PCR method is as follows: 95 °C for 2 min; 22 cycles of 95 °C (15 s), 55 °C (15 s), 72 °C (30 s); 72 °C for 7 min; hold at 4 °C. The PCR products were cleaned up using the ChargeSwitch PCR Clean-Up Kit, pooled in equimolar amounts, and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704). The DNA concentration was measured using the Qubit dsDNA BR assay kit and sequenced using a HiSeq SBS v4 50 cycle kit (Illumina FC-401-4002) and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001) on a HiSeq 2500 instrument (Illumina) in a single 50-base read with custom primer CTTAGCTCCCAGCGACCTGCTTCAATGTCGGATAGTG and 8-base index read 32 using custom primer CTGATGGAGGTAGAAGCCGCAGTGAGCATGGT (Supplementary Fig. 18).

Hudson L., Mason J.W., Westphal M.V., Richter M.J., Thielman J.R., Hua B.K., Gerry C.J., Xia G., Osswald H.L., Knapp J.M., Tan Z.Y., Kokkonda P., Tresco B.I., Liu S., Reidenbach A.G., Lim K.S., Poirier J., Capece J., Bonazzi S., Gampe C.M., Smith N.J., Bradner J.E., Coley C.W., Clemons P.A., Melillo B., Hon C.S., Ottl J., Dumelin C.E., Schaefer J.V., Faust A.M., Berst F., Schreiber S.L., Zécri F.J, & Briner K. (2023). Diversity-oriented synthesis encoded by deoxyoligonucleotides. Nature Communications, 14, 4930.

+ Open protocol

+ Expand

Illumina Library Preparation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

We fragmented DNA samples by Covaris S2 (intensity setting = 5, duty% = 10, burst cycles = 200, 50 s with frequency sweeping mode). Following the manufacturer recommended protocol, we took the fragmented DNA products into the NEBNext Ultra DNA Library Prep Kit for Illumina with 15 cycles of PCR with no size selection post ligation. We cleaned PCR amplified libraries using 1X AmpureXP Beads and quantified the indexed libraries individually and pooled at equal molar quantity. We gel-purified the pooled libraries by E-Gel EX Agarose Gels, 2% using E-Gel iBase Power System by Thermo Fisher Scientific. Finally, we excised a range of 350–500 bp and sequenced on a NextSeq500 using 2 × 150 paired-end read.
We prepared RNA samples using the Illumnia ScriptSeqv2 RNA-Seq library preparation kit following the manufacturer recommended protocol. The protocol follows a fragmentation at 85 °C for 5 min. Using ScriptSeq index PCR primers, we barcoded the libraries and PCR amplified 15 cycles. We quantified the indexed libraries individually and pooled at equal molar quantity. We gel-purified the pooled libraries by E-Gel EX Agarose Gels, 4% using E-Gel iBase Power System by Thermo Fisher Scientific. Finally, we excised a range of 350–500 bp and sequenced on a NextSeq500 using 2 × 150 paired-end read.

Prussin AJ I.I., Torres P.J., Shimashita J., Head S.R., Bibby K.J., Kelley S.T, & Marr L.C. (2019). Seasonal dynamics of DNA and RNA viral bioaerosol communities in a daycare center. Microbiome, 7, 53.

+ Open protocol

+ Expand

Evaluating Concatemer Lengths by Gel Electrophoresis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After extension, for internal quality control, the lengths of the concatemers were evaluated by diluting 1 μl of in vitro reaction with 19 μl water. For quality control, samples were then run on 1–2% E-Gel EX agarose gels (Thermo Fisher #G402001) for 10 min on the E-gel apparatus (Invitrogen, iBase) alongside a 1 kb Plus DNA Ladder (Invitrogen) and imaged with the SybrGold channel on a Typhoon FLA 9000 scanner.
For the comparison gel in Supplementary Fig. 6, unpurified concatemers were run using 6% TBE-UREA PAGE gels (Thermo Fisher) at 55°C. The gel was pre-run for 1 h before loading the samples. 160 ng Quick-Load Purple Low Molecular Weight DNA Ladder (NEB #N0557S) was loaded as size reference. The reaction products were diluted 1:7 with 2× Urea-Loading Dye, and denatured at 95°C for 5 min. 9 μl from each sample was loaded on the gel. Both samples and the ladder were denatured. Samples were run for 20 min at 75 V, and at 130 V for 1 h. Gels were stained with 1:10,000 SybrGold in 0.5× Tris-Borate-EDTA (TBE) for 30 min and scanned on a Typhoon FLA 9000 scanner.

Saka S.K., Wang Y., Kishi J.Y., Zhu A., Zeng Y., Xie W., Kirli K., Yapp C., Cicconet M., Beliveau B.J., Lapan S.W., Yin S., Lin M., Boyden E.S., Kaeser P.S., Pihan G., Church G.M, & Yin P. (2019). Immuno-SABER enables highly multiplexed and amplified protein imaging in tissues. Nature biotechnology, 37(9), 1080-1090.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!