Log In Sign up
The largest database of trusted experimental protocols

Applied biosystems 7900ht real time pcr instrument

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in Denmark

The Applied Biosystems 7900HT real-time PCR instrument is a high-throughput system designed for gene expression analysis, genotyping, and other real-time PCR applications. It features a 384-well format and supports a wide range of chemistries and fluorescent dyes. The system provides fast, precise, and reliable performance for a variety of real-time PCR workflows.

Automatically generated - may contain errors

Lab products found in correlation

Taqman preamp master mix, by Thermo Fisher Scientific (2 mentions) Taqman microrna rt kit, by Thermo Fisher Scientific (2 mentions) Nanodrop nd 1000 spectrophotometry, by Thermo Fisher Scientific (2 mentions) Rt preamp primers, by Thermo Fisher Scientific (2 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions) Mirneasy micro kit, by Qiagen (2 mentions) Genex software, by Qiagen (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Rt2 first strand kit, by Qiagen (1 mentions) Universal cdna synthesis kit, by Qiagen (1 mentions) 18s primers, by Thermo Fisher Scientific (1 mentions) Rna extraction mini kit, by Qiagen (1 mentions)

6 protocols using applied biosystems 7900ht real time pcr instrument

1

Quantitative Analysis of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extracted from M12 and P69 cell pellets was subjected to reverse transcription for analysis on Exiqon miRCURY LNA™ Universal RT microRNA PCR Panels I and II (Verson 2.M) (Exiqon A/S) and qPCR was conducted in an Applied Biosystems 7900HT real-time PCR instrument (Life Technologies) according to the manufacturer’s instructions. Threshold and baseline settings were set according to protocol recommendations. The data was corrected for interplate variability using on-plate calibrators, and normalized against the global mean using Exiqon GenEx software. Expression changes were calculated in Microsoft Excel® as using the 2-Δ ΔCT method [20 (link)] as M12 expression relative to P69.
Seashols-Williams S.J., Budd W., Clark G.C., Wu Q., Daniel R., Dragoescu E, & Zehner Z.E. (2016). miR-9 Acts as an OncomiR in Prostate Cancer through Multiple Pathways That Drive Tumour Progression and Metastasis. PLoS ONE, 11(7), e0159601.
+ Open protocol
+ Expand
2

Macrophage Response to Bacterial Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
RAW264.7 macrophages (1 × 106 cells/well) were untreated (negative control), treated with 1 μg/ml Escherichia coli LPS (Life Technology, Carlsbad, CA) or infected with Burkholderia spp. at a MOI of 10. At 4 and 8 h post-infection, RNA was isolated from RAW264.7 macrophages using Trizol® (Life Technology, Carlsbad, CA) according to the manufacturer’s protocol. Approximately 1 μg of purified RNA was subjected to genomic DNA elimination and cDNA synthesis using the RT2 first strand kit (Qiagen, Valencia, CA). cDNA was added to RT2 qPCR master mix and 25 μl was added to each well of a RT2 profiler mouse inflammatory chemokines and receptors plate (Qiagen, Valencia, CA). PCR amplification was performed using Applied Biosystems 7900 HT Real-time PCR instrument (Life Technology, Carlsbad, CA).
Chiang C.Y., Ulrich R.L., Ulrich M.P., Eaton B., Ojeda J.F., Lane D.J., Kota K.P., Kenny T.A., Ladner J.T., Dickson S.P., Kuehl K., Raychaudhuri R., Sun M., Bavari S., Wolcott M.J., Covell D, & Panchal R.G. (2015). Characterization of the murine macrophage response to infection with virulent and avirulent Burkholderia species. BMC Microbiology, 15, 259.
+ Open protocol
+ Expand
3

Quantification of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from WBMC with miRNeasy Micro kit (Qiagen) according the manufacturer’s protocol. RNA was measured by Nanodrop ND-1000 spectrophotometry (Fisher Scientific Inc.). 50ng of RNA was converted into cDNA using RT Primers and TaqMan microRNA RT Kit (Applied Biosystems), followed by cDNA preamplified using RT PreAmp Primers and Taqman PreAmp Master Mix (Applied Biosystems) according to the manufacturer’s protocol. 0.25 μl diluted PreAmp product was mixed with TaqMan Universal PCR Master Mix and miRNA primer and run using an Applied Biosystems 7900HT real-time PCR instrument (Applied Biosystems). The primers of miR125a-5p, miR210 and RNU6B were purchased from Applied Biosystems. RNU6B gene was used as the endogenous control. Results were analyzed using the δδCt method.
Wen S., Dooner M., Cheng Y., Papa E., Del Tatto M., Pereira M., Deng Y., Goldberg L., Aliotta J., Chatterjee D., Stewart C., Carpanetto A., Collino F., Bruno S., Camussi G, & Quesenberry P. (2016). Mesenchymal stromal cell derived extracellular vesicles rescue radiation damage to murine marrow hematopoietic cells. Leukemia, 30(11), 2221-2231.
+ Open protocol
+ Expand
4

Quantifying mRNA Expression via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA expression for specific genes in AAV5-GFAP-control and AAV5-GFAP-hIGF-1 -treated animals was assessed using real-time qRT-PCR. 200 ng of purified total RNA was used to generate cDNA, using a Universal cDNA Synthesis Kit (Exiqon, Denmark) according to the manufacturer’s protocol. 1 μL of cDNA samples were used as a PCR reaction template in a 10 μl PCR reaction. PCR reactions were run in triplicate on an Applied Biosystems 7900HT real-time PCR instrument (Applied Biosystems, CA) using a SYBR green-based real-time PCR reaction kit (Exiqon, Denmark). 18s mRNA was used as a normalization control. Specificity of the amplification was evaluated by thermal stability analysis of the amplicon. Individual and reference gene primer sets (Integrated DNA Technologies, Coralville, IA) are listed in the Table 1.
Okoreeh A., Bake S, & Sohrabji F. (2017). Astrocyte-Specific Insulin-Like Growth Factor-1 Gene Transfer in Aging Female Rats Improves Stroke Outcomes. Glia, 65(7), 1043-1058.
+ Open protocol
+ Expand
5

Quantification of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from WBMC with miRNeasy Micro kit (Qiagen) according the manufacturer’s protocol. RNA was measured by Nanodrop ND-1000 spectrophotometry (Fisher Scientific Inc.). 50ng of RNA was converted into cDNA using RT Primers and TaqMan microRNA RT Kit (Applied Biosystems), followed by cDNA preamplified using RT PreAmp Primers and Taqman PreAmp Master Mix (Applied Biosystems) according to the manufacturer’s protocol. 0.25 μl diluted PreAmp product was mixed with TaqMan Universal PCR Master Mix and miRNA primer and run using an Applied Biosystems 7900HT real-time PCR instrument (Applied Biosystems). The primers of miR125a-5p, miR210 and RNU6B were purchased from Applied Biosystems. RNU6B gene was used as the endogenous control. Results were analyzed using the δδCt method.
Wen S., Dooner M., Cheng Y., Papa E., Del Tatto M., Pereira M., Deng Y., Goldberg L., Aliotta J., Chatterjee D., Stewart C., Carpanetto A., Collino F., Bruno S., Camussi G, & Quesenberry P. (2016). Mesenchymal stromal cell derived extracellular vesicles rescue radiation damage to murine marrow hematopoietic cells. Leukemia, 30(11), 2221-2231.
+ Open protocol
+ Expand
6

Quantifying IGF-1R mRNA Expression in hBMEC

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human IGFlR mRNA expression in hBMEC was assessed using real-time qRT-PCR. Total RNA was extracted using QIAzol reagent and RNA Mini extraction kit (Qiagen, CA) using our previous procedures (Okoreeh et al., 2017 (link)). RNA yield and purity were evaluated with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies/Thermo Scientific). 100 ng of purified total RNA was used to generate cDNA, using a cDNA Synthesis Kit (Quantbio, MA) following manufacturer's protocol. cDNA was diluted 80 fold and real time PCR reaction were run on Applied Biosystems 7900HT real-time PCR instrument (Applied Biosystems, CA) using a SYBR green-based real-time PCR reaction kit (Quantabio, MA). 18s mRNA was used as a normalization control. Human IGF-lR (Forward:5'- TTA AGA ACC AGT GGC GAA AG -3',Reverse: 5'- GGA GCA CTC ACT TCT CCA AA -3' Realtime primers, PA) and 18S primers (Forward:%’- ATGGCCGTTCTTAGTTGGTG -3’; Reverse: 5’- CGCTGAGCC AGTCAGTGTAG-3 ’, Life Technologies, CA).
Bake S., Okoreeh A., Khosravian H, & Sohrabji F. (2018). Insulin-Like Growth Factor (IGF)-1 Treatment Stabilizes the Microvascular Cytoskeleton under Ischemic Conditions. Experimental neurology, 311, 162-172.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!