De go taq green master mix

Once the proviral DNA was amplified, a nested PCR was run, followed by enzymatic digestion for the confirmation of the HTLV infection and the differentiation of the virus types 1 and 2. For this, the pX region of the virus was amplified. This initial reaction was run in a solution containing 5.0 de Go Taq Green Master Mix (Promega Corporation, Madison, WI, USA), 2.0 μL of water, 1 μL (10 pmol) of each primer–HTLV_External F 5’-TTCCCAGGGTTTGGACGAAG-3’ (7,219–7,238, forward) and HTLV_External R 5’-GGGTAAGGACCTTGAGGGTC-3’ (7,483–7,464, reverse)–and 1.0 μL of the DNA, for a final volume of 10 μL.
In the second phase of the nested PCR, the same quantity of Go Taq Green Master Mix (Promega, Madison, WI, USA) was used, together with 1 μL (10 pmol) of the primers HTLV_internal F 5’CGGATACCCAGTCTACGTGTT3’ (7,248–7,268, forward) and HTLV_internal R 5’GAGCCGATAACGCGTCCATCG3’ (7,406–7,386, reverso), 2.5 μL of water and 0.5 μL of the product of the first PCR, producing a fragment of 159 bps.
Positive (a sample known to be infected) and negative controls were used for each PCR reaction. The products were electrophoresed (60 min at 100 V) in 2% agarose gel, stained with ethidium bromide in 1 × TAE buffer (TAE 50x stock—1.6 M Tris-Base, 0.8 M sodium acetate, and 40 mM EDTA-Na2 per liter of deionized water), and visualized using an ultraviolet transilluminator (Tuke et al., 1992 (link)).

Once the proviral DNA was amplified, a nested PCR was run, followed by enzymatic digestion for the confirmation of the HTLV infection and the differentiation of the virus types 1 and 2. For this, the pX region of the virus was amplified. This initial reaction was run in a solution containing 5.0 de Go Taq Green Master Mix (Promega, Madison, WI, USA), 2.0 μL of water, 1 μL (10 pmol) of each primer–HTLV_External F 5'-TTCCCAGGGTTTGGACGAAG-3' (7219–7238, forward) and HTLV_External R 5'-GGGTAAG GACCTTGAGGGTC-3' (7483–7464, reverse)–and 1.0 μL of the DNA, for a final volume of 10 μL.
In the second phase of the nested PCR, the same quantity of Go Taq Green Master Mix (Promega, Madison, WI, USA) was used, together with 1μL (10 pmol) of the primers HTLV_internal F 5'CGGATACCCAGTCTACGTGTT3' (7248–7268, forward) and HTLV_internal R 5'GAGCCGATAACGCGTCCATCG3' (7406–7386, reverso), 2.5 μL of water and 0.5 μL of the product of the first PCR, producing a fragment of 159 bps [16 (link)].
Positive (a sample known to be infected) and negative controls were used for each PCR reaction. The products were electrophoresed (60 minutes at 100 V) in 2% agarose gel, stained with ethidium bromide in 1x TAE buffer (TAE 50x stock—1.6 M Tris-Base, 0.8 M sodium acetate, and 40 mM EDTA-Na2 per liter of deionized water), and visualized using an ultraviolet transilluminator.