Obtained results were related to fully methylated and non-methylated standards of human DNA (OneStep qMethyl Kit, Zymo Research, USA). The samples were also normalized with three independent samples, which were measured in duplicate in each pool. The RUNX3 P2 methylation level of each sample was assessed through a comparison of the real-time amplification plots for PCR products and standards with a known ratio of methylated and unmethylated templates. A cycle threshold value was based on 5-methylcytosine content at the specific restriction site. As restriction enzymes recognized and cut unmethylated nucleotides between 3′ hydroxyl and 5′ phosphate groups, templates without methylation obtained higher Ct differences. The methylation level for a region spanned by the RUNX3 primers was established as a fold-change relative to Ct value differences for test and reference reactions, following a formula: methylation (%) = 100 x 2−ΔCt. Product characteristics and purity were determined using melting curves and peak analysis under the control of CFX Manager software.
Onestep qmethyl kit
Manufactured by Zymo Research
Sourced in United States
The OneStep qMethyl Kit is a quantitative DNA methylation analysis tool developed by Zymo Research. It provides a streamlined workflow for measuring DNA methylation levels in a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrofluorimeter, by Thermo Fisher Scientific (2 mentions)
Amplitaq gold, by Thermo Fisher Scientific (2 mentions)
Dna cleaning and concentrator kit, by Zymo Research (2 mentions)
Ez dna methylation direct kit, by Zymo Research (2 mentions)
Dneasy kit, by Qiagen (2 mentions)
Lightcycler 480 2, by Roche (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Genomic dna clean and concentrator kit, by Zymo Research (1 mentions)
Dna isolation kit for cells and tissue, by Roche (1 mentions)
Quantstudio 12k sequence detection system, by Thermo Fisher Scientific (1 mentions)
Real time pcr machine, by Bio-Rad (1 mentions)
Methylflash methylated dna quantification kit, by Epigentek (1 mentions)
Imark microplate absorbance reader, by Bio-Rad (1 mentions)
Cfx96 instrument, by Bio-Rad (1 mentions)
5 mc dna elisa kit, by Zymo Research (1 mentions)
Tango buffer, by Thermo Fisher Scientific (1 mentions)
Sybr green real time pcr master mix, by Thermo Fisher Scientific (1 mentions)
29 protocols using onestep qmethyl kit
1
Quantifying RUNX3 P2 Methylation
2
Epigenetic Regulation of Estrogen Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation analysis was preceded by an in silico search of the regulatory regions of ESR1 and ESR2 with the CpG Plot (http://www.ebi.ac.uk , accessed on 23 July 2021) and CpG Islands Searcher (http://cpgislands.usc.edu , accessed on 23 July 2021) tools. Sixty DNA samples originating from the VAT and SAT of 20 obese patients (5 metabolically healthy and 15 with metabolic complications of obesity: hypertension, diabetes, hyperlipidemia) and 10 normal-weight individuals were selected for methylation analysis. Analysis was performed using the methylation-sensitive digestion/real-time PCR method with the OneStep qMethyl Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol, as described previously [67 (link),69 (link)]. Primers used in the methylation analysis are presented in Supplementary Table S1 .
3
Methylation Analysis of MTORC1 and CSN1S1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA extraction and methylation analysis of MTORC1 and CSN1S1 were performed as described previously (Osorio et al., 2016) . In brief, DNA extraction and cleaning was performed with the DNeasy Blood and Tissue Kit (catalog no. 69504, Qiagen) and Genomic DNA Clean and Concentrator Kit (catalog no. D4013, Zymo Research, Irvine, CA). Identification of gene promoter region specific methylation containing CpG islands was based on the OneStep qMethyl kit (catalog no. D5310, Zymo Research) protocol. Nonmethylated DNA (negative control) was obtained by whole-genome amplification, and methylated control (positive control) was obtained by methylase reaction. The primers used in the present study were designed to cover the sections in the promoter region. Primers for the promoter region of MTORC1 and CSN1S1 covered from -1,802 to -1,631 bp and from -860 to -618 bp, and contained 2 CpG sites specific for the Methylation Sensitive Restriction Enzyme in the OneStep qMethyl kit. The primer list for methylation is reported in Supplemental Table S3 (https:// doi .org/ 10 .3168/ jds .2017 -13707).
4
Quantifying RUNX3 Promoter Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methylation level of the RUNX3 promoter was determined using the OneStep qMethyl Kit from Zymo Research. Analyses were performed in duplicate for each experiment. The final reaction volume of 20 µL contained premix with SYTO 9 dye, 10 pmol/µL of each primer, and 5 µL of DNA template. Reactions were carried out in the presence (test reaction) or absence (reference reaction) of MSRE (AccII, HpaII, and HpyCH4IV), as per the manufacturer’s guideline. Cycling conditions were as follows: MSRE digestion (37 °C, 2 h), initial denaturation (95 °C, 10 min), 40 cycles of three-step amplification (denaturation: 95 °C, 30 s; annealing: 54 °C, 60 s; extension: 72 °C, 60 s), and final extension (72 °C, 7 min). In addition, amplified products were melted in a temperature gradient to a maximum of 95 °C.
5
Quantifying Cytosine Methylation in Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cytosine methylations in target regions of the genomic DNA fragment I and fragment II (Fig 5 ) was quantified using methylation sensitive restriction enzymes (MSRE) and the qPCR approach according to the procedure of OneStep qMethyl Kit (Zymo Research, USA). Briefly: 0.9 μg of gDNA isolated from control and experimental plants (i.e. inoculated with BSMV:α,β(-),γ(-) or BSMV:α,β(pScBx1-fragment I),γ(pScBx1-fragment II) respectively) were suspended in a restriction buffer. Each of them was split into a test and a reference sample and only the test sample was digested with MSRE. DNA from the test and reference samples served as qPCR templates for amplification with primers (2811_Fw/2994_Re and 1448_Fw/1760_Re, S1 Table ) flanking the analyzed region. The difference between cycle threshold (Ct) values for test and reference DNA samples (i.e. ΔCt) was used to calculate the ratio of cytosine methylation according to the equation below [63 (link)]:
6
Quantitative DNA Methylation Analysis
7
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from the established cell cultures (5 x 106 cells
approximately) using DNA Isolation Kit for Cells and Tissues (Roche Diagnostics,
Mannheim, Germany). Methylation analyses were performed with One-Step qMethyl Kit
(Zymo Research, Irvine, CA, USA) using primers amplifying the MEFVCpG island, analyzed via qRT-PCR. Two reactions were setup as Test and Reference
reactions: The Test reaction includes Methylation Sensitive Restriction Enzymes
(MSREs) to cut at the methylated nucleotides, whereas the Reference reaction does not
contain these enzymes. Therefore, the Test reaction samples are cut if methylated,
creating smaller fragments, which result in lower Ct values.
The data was analyzed with qMethyl Calculator, which calculates the methylation ratio
as follows: Percent methylation = 100 x 2-ΔCt.
where ΔCt is the average Ct value from the Test reaction minus the average Ct value
from the Reference reaction.
approximately) using DNA Isolation Kit for Cells and Tissues (Roche Diagnostics,
Mannheim, Germany). Methylation analyses were performed with One-Step qMethyl Kit
(Zymo Research, Irvine, CA, USA) using primers amplifying the MEFVCpG island, analyzed via qRT-PCR. Two reactions were setup as Test and Reference
reactions: The Test reaction includes Methylation Sensitive Restriction Enzymes
(MSREs) to cut at the methylated nucleotides, whereas the Reference reaction does not
contain these enzymes. Therefore, the Test reaction samples are cut if methylated,
creating smaller fragments, which result in lower Ct values.
The data was analyzed with qMethyl Calculator, which calculates the methylation ratio
as follows: Percent methylation = 100 x 2-ΔCt.
where ΔCt is the average Ct value from the Test reaction minus the average Ct value
from the Reference reaction.
8
Epigenetic Analysis of WSB1 Promoter Methylation in Ascariasis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used an epigenetic approach to determine the level of methylation on the promoter region WSB1 following infection with A. lumbricoides using OneStep qMethyl kit (Zymo Research). Primers within the CpG rich (promoter) region of WSB1 were: forward, 5′-CAG GCC TTT GCA ATG TTT AGG-3′; reverse, 5′-AGC CAG CAG GTT TTA GGA AGG-3′. Methylation percentages were obtained using 20 ng of DNA in duplicate in test and reference reaction mixes. Reactions were done using a QuantStudio 12K Sequence Detection System (Applied Biosystems, Foster City, CA, USA) as follows: 2 h 37°C; 10 min 95°C; 40 cycles 30 s 95°C, 1 min 54°C, 1 min 72°C followed by an dissociation stage to check specificity of PCR products. The Ct values obtained were used to calculate ΔCt values Ct (test) and Ct (reference). Methylation percentages were calculated as the product of 100 × 2–ΔCt.
9
Genomic DNA Extraction and MSP Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5x105 cells were plated onto 6-cm dishes. Their genomic DNA was extracted using DNeasy kit (Qiagen), and purified using DNA Cleaning and Concentrator kit (Zymo Research) following manufacturer’s instructions. 20 ng/well of genomic DNA, quantified using Qubit, were digested using OneStep qMethyl kit (Zymo Research) following manufacturer’s protocol. Primers used are listed in the SI Table 1 .
For methyl specific PCR (MSP) assay 500 ng of purified DNA were bisulphate converted using the EZ-DNA Methylation-direct kit (Zymo Research) following manufacturer’s datasheet. 50 ng of bisulphate-converted DNA, quantified using Nanodrop spectrofluorimeter, were used for PCR reaction with AmpliTaq Gold (Life Technology) following manufacturer’s protocol. The number of amplification cycles used was thirty. Methylation specific primers were designed using MethPrimer31 (link) (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ) and are listed in the SI Table 1 .
For methyl specific PCR (MSP) assay 500 ng of purified DNA were bisulphate converted using the EZ-DNA Methylation-direct kit (Zymo Research) following manufacturer’s datasheet. 50 ng of bisulphate-converted DNA, quantified using Nanodrop spectrofluorimeter, were used for PCR reaction with AmpliTaq Gold (Life Technology) following manufacturer’s protocol. The number of amplification cycles used was thirty. Methylation specific primers were designed using MethPrimer31 (link) (
10
Quantifying mtDNA Methylation Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted with DNeasy Blood & Tissue Kits (Qiagen, Valencia, CA, USA). 20 ng of genomic DNA were used for mtDNA methylation. mtDNA methylation was measured by OneStep qMethyl Kit (ZYMO RESEARCH), which contain Methylation Sensitive Restriction Enzymes (MSREs: AccII, HpaII, and HpyCH4IV) according to the manufacturer’s instruction. Briefly, each 20 ng DNA is divided into two tubes: a test reaction and a reference reaction. In test reaction, DNA was digested with MSREs while in the reference reaction was not. The DNA from both samples is then amplified using real-time PCR machine (Biorad), then CT values for test and reference DNA samples were quantified for the percent methylation levels. Percent methylation is determined by the equation: 100 × 2−ΔCT. ΔCT is the average CT from the test reaction minus the average CT from the reference reaction. The primers used for amplification are: GRSF-1 promoter Forward primer (5′GACAGGCTCCTTCCCTACAA3′), and Reverse primer (5′ACCTCGCATCTTCTTGCTTT3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!