We searched the PharmGKB database and 52 random VIP variants of 27 genes were ultimately selected for our study according to available data on frequency, functionality, and linkage based on published research. The method of operation used was to extract the genomic DNA of peripheral blood according to the GoldMag-Mini whole blood genome DNA Purification Kit (GoldMag Ltd. Xi'an, China). The DNA concentration was measured by a NanoDrop 2000C spectrophotometer (USA). Agena MassARRAY Assay Design 4.0 software (San Diego, California, USA) was used to design multiple SNP MassEXTEND arrays (Gabriel et al., 2008) and to design primers and single base extension primers for the selected sites. The PCR primers for the selected variants are presented in Supplementary Table 1 . Following the instructions provided by the manufacturer, we used Agena MassARRAY RS1000 (San Diego, California, USA) to determine the genotype of the SNP. A brief overview of the Agena MassARRAY RS1000 (San Diego, California, USA) method for genotyping were as follows: (1) PCR amplification, (2) SAP purification, (3) iPLEX single base extension reaction, (4) resin exchange, and (5) mass spectrometry detection. Finally, Agena Typer 4.0 software was used for data statistics and analyses (Thomas et al., 2007) [32 (link)].
Massarray assay design 4
Manufactured by Agena
Sourced in United States
Agena MassARRAY Assay Design 4.0 is a software application that assists in the design of genetic assays using the MassARRAY system. The core function of the software is to facilitate the selection and optimization of DNA sequence targets and primers for use in the MassARRAY platform.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Massarray rs1000, by Agena (6 mentions)
Typer 4, by Agena (3 mentions)
Massarray system, by Agena (2 mentions)
Du530 uv vis spectrophotometer, by Beckman Coulter (2 mentions)
Massarray analyser compact maldi tof ms, by Agena (2 mentions)
Spectroclean resin, by Labcorp (2 mentions)
Spectrochips genii, by Labcorp (2 mentions)
12 protocols using massarray assay design 4
1
Genotyping 52 VIP Variants Using Agena MassARRAY
2
CYP2B6 SNPs and COPD Risk in Chinese Han
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This study focused on the relationship between CYP2B6 SNPs and COPD risk in Chinese Han population. Based on the 1000 Genomes database (http://www.internationalgenome.org/ ), we finally identified five candidate polymorphisms (rs2099361, rs4803418, rs4803420, rs1038376, and rs12979270) for the present case–control study. Each SNP had the minor allele frequency (MAF)>0.05 in global population from the 1000 Genome Project. Agena MassARRAY Assay Design 4.0 software was used to design the primers for amplification and extension reactions. Genotyping was carried out by two laboratory personnel in a double-blinded fashion using the Agena MassARRAY system (Agena, San Diego, CA, USA.).24 The primers used for the five SNPs are shown in Table 1 .
Primers used for this study
| SNP_ID | 2nd PCR | 1st PCR | UEP DIR | UEP SEQ |
|---|---|---|---|---|
| rs12979270 | ACGTTGGATGCTGTTGTAGACCACAGTCAC | ACGTTGGATGTGATAGACGGAAGCAGTAGG | F | gCTGCTGTAGTCTTCCCC |
| rs4803420 | ACGTTGGATGTGAAAACATTTGGAGCTAGG | ACGTTGGATGAGCTGGTATCACAGGCGTC | R | ggggaTGACATCAGGAGTTCAAGA |
| rs2099361 | ACGTTGGATGCACAATGGACAATGTCAACG | ACGTTGGATGTTTGTACATCCAGTGGGCTC | F | gtcacCGTAGTTGAGTGATTCTTTAC |
| rs1038376 | ACGTTGGATGCAACATGAAAGCAACCAGAC | ACGTTGGATGTTTAGTAGGGACATGTTGGC | R | caccTTATGCCTGTAATATCAGCACTT |
| rs4803418 | ACGTTGGATGGCAAAGAGAAATTGAGGCAG | ACGTTGGATGTCTCTCTGGTTCTCACTTGC | F | gggcGGCAGAGAAAATTAGAGAGA |
3
Genetic Variant Analysis of IL1R1 and IL1R2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in EDTA tubes and stored at −80°C after centrifugating by 17,528 g in 10 min. GoldMag extraction method (GoldMag Co Ltd, Xi'an, China) was used to extract genomic DNA from whole blood, and DNA concentrations were measured using a NanoDrop 2000. Ten tag SNPs in the IL1R1 and IL1R2 gene were selected for our study, and these SNPs were with minor allele frequencies (MAFs) >5% in 1,000 genome (http://www.internationalgenome.org/ ). Agena MassARRAY Assay Design 4.0 Software was used to design a Multiplexed SNP MassEXTEND assay. SNP genotyping was performed by using Agena MassARRAY RS1000 according to the manufacturer's protocol (Gabriel, Ziaugra, & Tabbaa, 2009 ). Agena Typer 4.0 software was used for data management and analysis.
4
Genetic Profiling of MMP2 and MMP10
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on data from the database (dbSNP and GWASs), eight SNPs of MMP2 and MMP10 were selected. All SNPs we selected had minor allele frequencies > 5% in the global population from the 1000 Genome HapMap database. We collected blood samples into EDTA tubes after centrifugation at 2000 rpm for 10 minutes. Blood samples kept at -80°C for future experiments. Genomic DNA was obtained from whole blood using GoldMag extraction method (GoldMag, China) and then stored at -20°C. We evaluated DNA quantity using spectrophotometry (DU530UV/VIS spectrophotometer, Beckman Instruments, Fullerton, CA, USA). Agena MassARRAY Assay Design 4.0 Software was implemented to develop the Multiplexed SNP Mass EXTEND assay. Agena MassARRAY RS1000 system was carried out to measure the SNP genotypes by the manufacturer's protocol. Data management and analyses were performed using the Agena Bioscience Typer 4.0 software.
5
Genotyping of SNPs in ZC3HC1 and SMARCA4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight SNPs in ZC3HC1 and SMARCA4 had minor allele frequencies greater than 5% in the 1000 Genomes Project (http://www.internationalgenome.org/ ). A GoldMag‐Mini Purification Kit (GoldMag Co. Ltd.) was performed to extract genomic DNA from whole blood. DNAs were stored at −80°C until analysis. DNA concentrations were measured using a NanoDrop 2000 (Thermo Scientific). The primers were designed online (https://agenacx.com/online-tools/ ). Agena MassARRAY Assay Design 4.0 software was used to design multiplexed SNP MassEXTEND assay, and SNP genotyping was performed utilizing the Agena MassARRAY RS1000 as recommended by the manufacturer. Agena Typer 4.0 software was used to perform data management and analyses.
6
Genomic DNA Extraction and SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from participant's peripheral venous blood by a Gold Mag Mini Whole Blood Genomic DNA Purification Kit (GoldMag Ltd) following the manufacturer's protocol and then stored at −80°C before genotyping. The concentration and purity of DNAs were determined by the NanoDrop 2000 (Thermo Scientific).
We established the following criteria to identify the target SNPs: (a) MAF (minor allele frequency) of Han Chinese in Beijing (HCB) > 0.05 and disease relevance in 1,000 genome (http://www.internationalgenome.org/ ); (b) a linkage disequilibrium value of r2 < .8 for each target SNPs. Agena MassARRAY Assay Design 4.0 software was used to design the primers for amplification and extension reactions. Agena MassARRAY RS1000 was used to perform SNP genotyping according to the standard protocol. Two staffs independently operated genotyping assay and randomly selected more than 10% samples for verification, and the results were exactly same in two sets of assays. Then, Agena Typer 4.0 software was applied to analyze and manage our data. The PCR primers for each SNP are shown in Table 1 .
We established the following criteria to identify the target SNPs: (a) MAF (minor allele frequency) of Han Chinese in Beijing (HCB) > 0.05 and disease relevance in 1,000 genome (
7
Genotyping of TIMP Genetic Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A GoldMag–Mini Purification Kit (GoldMag Co Ltd, Xian City, China) was used to extract genomic DNA from whole-blood samples. DNA samples were stored at − 20°C prior to analysis. At the same time, the concentrations and purity of the DNA were measured by using the NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA) at a wavelength of A260 and A280 nm.
Ten tag SNPs in TIMP2 and TIMP3 were selected for our study. These SNPs had minor allele frequencies greater than 5% according to the 1000 Genomes Project (http://www.internationalgenome.org/ ). The primers were designed online (https://agenacx.com/online-tools/ ). Agena MassARRAY Assay Design 4.0 software was used to design a multiplexed SNP MassEXTEND assay, and SNP genotyping was performed using the Agena MassARRAY RS1000 with manufacturer protocols. Agena Typer 4.0 software was used to perform data management and analyses.
Ten tag SNPs in TIMP2 and TIMP3 were selected for our study. These SNPs had minor allele frequencies greater than 5% according to the 1000 Genomes Project (
8
Blood DNA Extraction and SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five-milliliter blood samples were collected in EDTA test tubes, centrifuged at 2000 rpm for 10 min, and stored at − 80 °C for future experiments. Genomic DNA was extracted by GoldMag extraction (GoldMag, China) and stored at 20 °C. The multichannel SNP quality extension detection method was developed using Agena MassARRAY Assay Design 4.0 software. The Agena MassARRAY system was used for SNP genotyping. Agena Bioscience Typer 4.0 software was used for data management and analysis. In addition, approximately 10% of the total samples were randomly selected for repeat genotyping, and the reproducibility was 100%.
9
APOE Genotyping for Alzheimer's Risk
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APOE genotype, the strongest genetic risk factor for Alzheimer’s disease with effect on memory over the adult life course [42 (link)], was assessed through a venous blood sample. Genetic determination of APOE allelic status was performed using a polymerase chain reaction (PCR)-based assay designed with the MassARRAY Assay Design 4.0 software (Agena Bioscience, San Diego, CA, USA). The initial PCR step involved 45 cycles with an annealing temperature of 56 °C. The PCR products were treated with shrimp alkaline phosphatase for 15 min at 37 °C and denatured at 85 °C for 5 min. The final iPLEX extension step involved 40 cycles of lots of five cycles between 52 °C and 85 °C. The resulting iPLEX extension products were desalted using SpectroCLEAN resin (SEQUENOM, San Diego, CA, USA), then spotted on SpectroCHIPs GenII (SEQUENOM, San Diego, CA, USA) and analysed with the MassARRAY Analyser Compact MALDI-TOF MS (Agena Bioscience, San Diego, CA, USA). Participants were categorised as possessing at least one copy of the ε4 allele from the APOE (ε4 carrier) or no copies of this polymorphism (non-ε4).
10
APOE Genotyping by PCR-based Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APOE genotype was assessed in whole blood using a polymerase chain reaction (PCR)-based assay, designed with the MassARRAY Assay Design 4.0 software (Agena Bioscience, San Diego, CA, USA). The initial PCR step involved 45 cycles (annealing temperature of 56 °C), and the PCR products were treated with shrimp alkaline phosphatase (15 min at 37 °C) and denatured at 85 °C for 5 min. The iPLEX extension step had 40 cycles of lots of five cycles (between 52 °C and 85 °C). The resulting iPLEX extension products were desalted using SpectroCLEAN resin (SEQUENOM, San Diego, CA, USA) and then spotted on SpectroCHIPs GenII (SEQUENOM, San Diego, CA, USA) for analysis with the MassARRAY Analyser Compact MALDI-TOF MS (Agena Bioscience, San Diego, CA, USA). In this study, APOE carrier status was defined by the presence (1 or 2 copies: ε4 carrier) or absence (0 copies: non-ε4 carrier) of the APOE ε4 allele.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!