For in vitro transcription of human 13C-labeled U1 snRNA, a cDNA fragment encoding U1 snRNA was amplified by PCR from random primed HeLa cDNA library and inserted into the EcoRI/XhoI sites of plasmid pBluescript II KS(+) (Agilent Technologies, Inc.). 13C-labeled U1 snRNA was transcribed in vitro from SpeI-linearized plasmid (1 μg) using Megascript T3 kit (Thermo Fisher Scientific). To transcribe 13C-labeled U2 snRNA, a cDNA fragment encoding human U2 snRNA was amplified from random primed TK6 cDNA library by PCR, inserted into HindIII/XhoI sites of pcDNA3.1(+) vector using a GeneArt Seamless Cloning and Assembly Enzyme Mix (Thermo Fisher Scientific) and used as a template DNA for the transcription after linearized with XhoI (1 μg). For RNase T1 digestion, RNA was synthesized using Guanosine-13C10 5′-triphosphate, whereas for RNase A digestion, cytidine-13C9 5′-triphosphate and uridine-13C9 5′-triphosphate were used instead of the respective 5′-triphosphate reagent that contained carbons with natural isotope distribution. The 13C-labeled U1 or U2 snRNA was precipitated in ethanol, solubilized in nuclease-free water and then purified further by reversed-phase LC as described above. The 13C-labeled 28S, 18S and 5.8S rRNA were synthesized as described (44 (link)). Primer sequences used for PCR are listed in Supplementary Table S2 .
Megascript t3 kit
Manufactured by Thermo Fisher Scientific
The Megascript T3 kit is a tool used for in vitro transcription. It provides reagents and protocols to synthesize and produce high yields of capped and polyadenylated RNA transcripts from DNA templates. The kit is intended for research use only.
Automatically generated - may contain errors
Lab products found in correlation
Poly a tailing kit, by Thermo Fisher Scientific (4 mentions)
Cap structure analog, by New England Biolabs (4 mentions)
Pbluescript 2 ks, by Agilent Technologies (2 mentions)
Megaclear kit, by Thermo Fisher Scientific (2 mentions)
Pbluescript ks, by Agilent Technologies (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Geneart seamless cloning and assembly enzyme mix, by Thermo Fisher Scientific (1 mentions)
Megascript t7 kit, by Thermo Fisher Scientific (1 mentions)
Monarch total rna miniprep kit, by New England Biolabs (1 mentions)
Northernmax gly gel prep running buffer, by Thermo Fisher Scientific (1 mentions)
Ultrahyb hybridization buffer, by Thermo Fisher Scientific (1 mentions)
Brightstar plus, by Thermo Fisher Scientific (1 mentions)
Typhoon phosphorimager, by GE Healthcare (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Megascript sp6 kit, by Thermo Fisher Scientific (1 mentions)
Npfu forte dna polymerase, by Enzynomics (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Enzynomics (1 mentions)
Oligonucleotides, by Cosmogenetech (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Dimethyldioctadecylammonium bromide, by Merck Group (1 mentions)
14 protocols using megascript t3 kit
1
Preparation of 13C-labeled Human snRNAs for NMR Analysis
2
Pig M-RAS Open Reading Frame Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frames of pig M-RAS (Table 1) were amplified from cDNA prepared from pig embryos. Amplified PCR products were subcloned into the pRN3 vector, and in vitro transcription was performed with a MEGAscript T3 Kit (Thermo Fisher Scientific).
3
CRISPR/Cas9 Genome Editing in Eggs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pHTBCas9 was linearized with XhoI. mRNAs of Cas9 were synthesized using Megascript T3 kit (Ambion), poly (A) tailing kit (Ambion), and Cap structure analog (New England Biolabs). pDR274 vectors encoding sgRNAs were linearized with DraI. sgRNAs were synthesized using Megascript T7 kit (Ambion). RNA was microinjected into unfertilized eggs according to a previously described method (Hikosaka et al. 1992 ). The volume of the injected media in an egg was approximately 30 pl. Electroporation of plasmids into 1-cell embryos was performed according to the previous report (Corbo et al. 1997 (link); Treen et al. 2014 (link)). Forty micrograms of the expression vector of Cas9 and 20 μg of sgRNA expression vectors were simultaneously electroporated for each electroporation. After electroporation, the embryos were washed in filtered seawater three times to remove excess plasmid DNA.
4
Ci-pem cDNA Amplification and mRNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ci-pem cDNA was amplified by PCR and subcloned into pBS-RN328 (link) to create pRN3CipemFL. mRNA was synthesized using the Megascript T3 kit (Ambion), the poly (A) tailing kit (Ambion), and Cap structure analog (New England Biolabs). Microinjection of mRNA was performed according to a previous report29 . The concentration of mRNA in the injection medium was adjusted to 500 ngμl−1.
5
Microinjection of eGFP mRNA into Unfertilized Eggs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
eGFP mRNA was synthesized using the MEGAscript® T3 kit (Ambion, Carlsbad, CA), the Poly(A) Tailing Kit (Ambion), and Cap structure analog (New England Biolabs, Ipswich, MA) as described60 (link). We microinjected eGFP mRNA into unfertilized eggs derived from Tg[MiCiTnIGCipemG]2 or wild-type animals as described61 (link). The microinjected unfertilized eggs were fertilized by sperm of counterpart animals so as to unify the genetic background. The concentration of mRNA in the injection medium was adjusted to 500 ngμl−1. After the embryos were fixed at the appropriate stage, whole-mount in situ hybridization (WISH) was performed as described60 (link),62 (link). The eGFP fluorescence was observed with a fluorescent microscope at the late tailbud stage.
6
Knockdown of maternal impα2 mRNA in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template DNA was amplified from impa2 cDNA clone K9 by PCR using forward primer 5´-GCGCGAATTAACCCTCACTAAAGGG CTCCCGAACAGATCGTCG-3´ (ntd 1483–1500 of GenBank accession no. BT003258) and reverse primer 5´- GCGCGAATTAACCCTCACTAAAGGG AATCATTCAAACAATTCATTATTTATTGACAACTTTG-3´ (complementary to ntd 2447–2483 of GenBank accession no. BT003258), both of which contain the promoter sequences for T3 RNA polymerase (shown in bold) at their 5´-ends. dsRNA was transcribed in vitro from the amplified DNA with T3 RNA polymerase (MEGAscript T3 kit, Ambion). dsRNA (0.1 nl of a 1.7 μg/μl solution) was injected into the posterior pole of pgc nos embryos at early stage 2. Because knockout of maternal impα2 mRNA results in developmental arrest at early cleavage stage [82 (link)], we performed partial knockdown of impα2 mRNA by precisely regulating the injection volume using a thin glass needle (hole diameter = 3 μm). Injected embryos were fixed in a 1:1 mixture of heptane and fixative II for 20 min, and the vitelline membrane was removed in PBS using a tungsten needle. Fixed embryos were processed for in situ hybridization with an antisense ftz RNA probe, as described above. The pole cells located within 30 μm of median section of confocal serial images were counted.
7
Transgenic Ciona Ascidian Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transgenic ascidian was generated as described previously (24 (link), 25 (link)). In brief, Minos transposase mRNA was synthesized using Megascript T3 kit, poly (A) tailing kit (Ambion, Carlsbad, CA) and Cap structure analog (New England Biolabs, Ipswich, MA). Both Minos mRNA and pMiDestF-CiVP 5’- UTR-Venus vector were electroporated into dechorionated and fertilized Ciona eggs (26 (link)). Subsequently, the electroporated eggs were cultured on agar-coated petri dishes with Millipore-filtered sea water. We raised the founder ascidian emitting Venus fluorescence, and its sperms were mated with wildtype ascidian eggs to obtain F1 progeny. Gametes of grown F1 progeny were then mated to generate transgenic F2 progeny.
8
Synthesis of Isotopically Labeled rRNA for qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the plasmids for in vitro transcription of our internal standard RNAs, the DNA of human 5.8S rRNA and S. pombe 5S, 5.8S, 18S and 25S rRNA was amplified by polymerase chain reaction (PCR) from genomic DNA. The primers used for the PCR are given in Supplementary Table S1. The amplified DNA of each rRNA was inserted into the XhoI/EcoRI, XhoI/HindIII, KpnI/HindIII or HindIII/NotI sites of plasmid pBluescript II KS (Agilent Technologies, Inc.). Before in vitro transcription, the plasmid was linearized with SpeI to terminate the product at the end of the rRNA. To synthesize RNA, 2 μg of template DNA was incubated and transcribed using a Megascript T3 kit (Invitrogen). When RNA was synthesized, guanosine-13C10 5′-triphosphate, cytidine-13C9 5′-triphosphate or uridine-13C9 5′-triphosphate solution was used instead of the respective 5′-triphosphate reagent that contained carbons with a natural isotope distribution. The RNA was precipitated in ethanol, solubilized in nuclease-free water and then purified further by reversed-phase LC as described above.
9
Northern Blot Analysis of Pten Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mammalian cell lines was extracted with either the miRNEasy mini kit (Qiagen) or the Monarch total RNA miniprep kit (NEB). Depending on the level of expression, 1–4 μg of total RNA was loaded on 1% agarose-glyoxal gel prepared with NorthernMax-Gly gel prep running buffer (Ambion) and transferred to nylon membranes (BrightStar-Plus, Invitrogen). Probes were synthesized using DECAprime II (Invitrogen) with α-32P dATP, or MEGAscript T3 kit (Invitrogen) with α-32P UTP. Hybridization was performed overnight at 42 or 68°C in ULTRAHyb hybridization buffer (Ambion). Membranes were then washed and exposed overnight onto imaging plates and imaged on Typhoon phosphorimager (GE). Primers used to amplify both human and mouse Pten probes were (TDO1774) 5′-ACCAGGACCAGAGGAAACCT-3′ and (TDO1775) 5′-GAATGCTGATCTTCATCAAAAGG-3′.
10
Reverse Transcription of RNA by GsI-IIC Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PE reactions with GsI-IIC RT were carried out by using a 50-nt and 5′-labeled DNA primer (PE primer) annealed near the 3′ end of a 1.1-kb in vitro–transcribed RNA. The transcript was generated by T3 runoff transcription (T3 MEGAscript kit; Thermo Fisher Scientific) of pBluescript KS (+) (Agilent) linearized using XmnI (New England Biolabs) and cleaned up using a MEGAclear kit (Thermo Fisher Scientific). The labeled DNA primer was mixed with the RNA template at a ratio of 1:1.2 and annealed by heating to 82 °C for 2 min followed by slowly cooling to room temperature to yield a final duplex concentration of 250 nM. GsI-IIC RT (200 nM) was preincubated with 20 nM of the annealed template–primer substrate in 25 μl of reaction medium containing 200 mM NaCl, 5 mM MgCl2, 20 mM Tris–HCl at pH 7.5, and 5 mM DTT for 30 min at room temperature, and reverse transcription was initiated by adding 1 μl of the 25 mM dNTP mix to give a final dNTP concentration of 1 mM for each dNTP. After incubating at 60 °C for times indicated in the legends to the figures, the reaction was terminated, processed, and analyzed by electrophoresis in a denaturing 6% polyacrylamide gel, as described previously for TS reactions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!