Mirna taqman probe

Small RNA sequencing data was validated using qRT-PCR. Total RNA samples were reverse transcribed using TaqMan RT-PCR microRNA assays (Applied Biosystems) according to the manufacturer’s instructions. Real-time PCR reactions were run in quadruplicate using the ABI 7900HT Fast Real-Time PCR System and data was collected using the Sequence Detection System 2.4 (SDS) software (Applied Biosystems). Expression of miRNAs was quantified using miRNA TaqMan probes (Applied Biosystems) and calculated using the Absolute Quantitation (AQ) standard curve method. RNU6B was used as an endogenous control as it showed expression levels that remained relatively constant with low variance and high abundance across the samples tested.

qPCR experiments were performed as previously described^{58 (link)}. PND21 and 35 male and female C57BL/6J mice were rapidly decapitated and their brains were flash frozen in 2-methylbutane (Fisher Scientific, Hampton, NH, USA). Brains were sliced in 1-mm-thick coronal slices using a cryostat and VTA, NAcc, and mPFC punches were taken from the resulting sections. Total RNA and microRNA were extracted from the VTA punches using an mRNAeasy Micro Kit (Qiagen). Dcc mRNA was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), and real-time PCR was performed using a TaqMan assay kit (Applied Biosystems) on a 7900HT RT PCR system (Applied Biosystems) in technical triplicates. Gapdh was used as a reference gene to control for experimental variability. A TaqMan MicroRNA Reverse Transcription Kit was used alongside the corresponding miRNA TaqMan probes (Applied Biosystems, Foster City, CA) to reverse transcribe and perform Real-Time PCR for miR-218, and expression levels were calculated using the AQ standard curve method. The small nucleolar RNA (snoRNA) RNU6B was used as an endogenous control to normalize miR-218 expression.

To quantify miR-30b-5p expression, total RNA enriched with small RNA was extracted using the mirVana™ miRNA Isolation Kit (Thermo Fisher Scientific) and analyzed by RT-qPCR using miRNA TaqMan® probe (Assay ID: 000602, miRbase accession# MI0000441, mature miRNA sequence: UGUAAACAUCCUACACUCAGCU) from Applied Biosystems/Thermo Fisher Scientific). mir-30b-5p mimic (Assay ID: MC10986), miRNA mimic negative control (#4464058), miR-30b-5p inhibitor (Assay ID: MH10986), Mir-30b-5p inhibitor negative control (#4464076) were all purchased from Applied Biosystems/Thermo Fisher Scientific. SMCs were transfected with 80 nM of the indicated mimic, mimic negative control, miRNA inhibitor, or inhibitor negative control using the Neon® transfection system (MPK-5000; Invitrogen, Waltham, MA). SMCs were microporated using the following parameters: pulse voltage: 1,300 V; pulse width: 20 ms; pulse number: 2; the tip type: 10 μl) and then cultured for 24 hr. The transfection efficiency was ∼51% with 2% cell death as determined using the pEGFP-N1 vector (#6081-5; addgene). Transfections with the indicated mimics and inhibitors did not significantly modulate SMC shape, viability, or adherence (trypan blue dye exclusion; data not shown).