Anti fra1 r 20

Cell lysates were prepared in lysis buffer containing 0.5% Nonidet P-40 as described (36 (link)). For immunoprecipitation, 0.5–1.0 mg of lysate was used with agarose-immobilized anti-FLAG M2 antibody (Stratagene). Bead-bound proteins were isolated by boiling in 2× SDS sample buffer followed by separation on SDS-polyacrylamide gels. Immunoblotting was performed with the following antibodies: anti-p73 (ER15 and GC15, Oncogene), anti-FLAG M2, anti-phosphorylated c-Jun Ser-63 (9261, Cell Signaling Technology), anti-c-Jun (60A8, Cell Signaling Technology), anti-Fra1 (R-20, Santa Cruz Biotechnology), and anti-actin (Sigma).

Two shRNAmirs targeting FRA1 (shFRA1 A: 5′ CCTGGTGCCAAGCATCAACA 3′ and shFRA1 B: 5′ TGGACAGTATCCCACATCCAAC 3′) were designed using the RNAi Codex database [49] (link) and cloned into the LMP retroviral vector (Open Biosystems). The LMP vector containing a non-silencing shRNA (shControl) was a gift from Dr Gretchen Poortinga. The pBABE-puro-FLAG-FRA1 construct was generated by PCR-mediated fusion of a FLAG epitope to the N-terminus of FRA1. The following antibodies were used in this study: anti-FRA1 (R-20; Santa Cruz Biotechnology), anti-FLAG M2 (Sigma-Aldrich), anti-14-3-3 (Santa Cruz Biotechnology), anti-vimentin (Cell Signalling Technology), anti-E-Cadherin (BD Transduction Laboratories), anti-ZO-1 (BD Transduction Laboratories), anti-14-3-3 (BD Transduction Laboratories) and anti-β-catenin (BD Transduction Laboratories).