Human primary mir 181b1

Manufactured by Thermo Fisher Scientific

Human-primary-miR-181b1 is a laboratory product used for research purposes. It is a precursor microRNA (pre-miRNA) molecule derived from the human genome. Pre-miRNAs are involved in the biogenesis of mature microRNAs, which play a role in regulating gene expression. The core function of Human-primary-miR-181b1 is to serve as a tool for studying microRNA biology and its applications in research.

Automatically generated - may contain errors

Lab products found in correlation

3 protocols using human primary mir 181b1

Quantitative Analysis of miRNA-181b Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissues were homogenized using TissueLyser II (Qiagen) according to manufacturer/s instructions. RNA isolation was using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), human-HPRT (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-HPRT (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. Changes in expression were calculated using delta delta Ct method.

Zhou H., Yang D., Cheng H.S., McCoy M.G., Pérez-Cremades D., Haemmig S., Wong D., Chen L, & Feinberg M.W. (2022). miR-181b regulates vascular endothelial aging by modulating a MAP3K3 signaling pathway. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 36(6), e22353.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissues were homogenized using TissueLyser II (Qiagen) according to manufacturer’s instructions. For RNA isolation TRIzol reagent (Invitrogen) or RNeasy kit (Qiagen) was used based on manufacturers protocol. Subsequent RT-qPCR was performed using High-Capacity cDNA Reverse Transcription kit (4368813, Applied Biosystems). For SyberGreen-based assay GoTaq qPCR Master Mix (A6001, Promega) was used; and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to Hprt, β-actin, or U6 (Aglient, AriaMx Real-Time PCR System). Specific primers including Mir181b-5p (#001098), U6 (#001973), human-primary-miR-181a1b1 (#Hs03302966_pri), human-primary-miR-181a2 (#Hs03302889_pri), human-primary-Mir181b1 (#Hs03302963_pri), for TaqMan system were purchased from Life Technologies. Changes in expression were calculated using deltadelta Ct method. Primer sequences are described in (Supplementary file 2).

Yang D., Haemmig S., Zhou H., Pérez-Cremades D., Sun X., Chen L., Li J., Haneo-Mejia J., Yang T., Hollan I, & Feinberg M.W. (2021). Methotrexate attenuates vascular inflammation through an adenosine-microRNA-dependent pathway. eLife, 10, e58064.

+ Open protocol

+ Expand

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from intima, PBMCs, and BMCs were isolated using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay, GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), snoRNA234 (ID# 001234), human-Hprt (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-Hprt (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03 307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. VE-Cadherin forward primer CACTGCTTTGGGAGCCTTC and reverse primer GGGGCAGCGATTCATTTTTCT were used to detect VE-Cadherin mRNA expression. GAPDH primers are forward AGGTCGGTGTGAACGGATTTG and reverse TGTAGACCATGTAGTTGAGGTCA. Changes in expression were calculated using deltadelta Ct method. Primer sequences are described in (Supplemental Table SII).

Yang D., Haemmig S., Chen J., McCoy M., Cheng H.S., Zhou H., Pérez-Cremades D., Cheng X., Sun X., Haneo-Mejia J., Vellarikkal S.K., Gupta R.M., Barrera V, & Feinberg M.W. (2022). Endothelial cell-specific deletion of a microRNA accelerates atherosclerosis. Atherosclerosis, 350, 9-18.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!