First strand cdna synthesis kit

The hypothalamus was separated from six sacrificed rats in each group after 30 min of EA as previously described (Cui et al., 2017 (link)). Briefly, two cuts were made transsectionally at the apex of the optic chiasm and the rostral margin of the mammillary bodies, respectively, on the ventral surface of the brain; the other two cuts were placed sagittally on either edge of the mammillary bodies after the middle slab was placed flat; the last cut was placed coronally just ventrally to the third ventricle. Then, the hypothalamus was isolated and was ground in liquid nitrogen immediately. Half of the hypothalamus was used to RNA analysis (the others were used for hormone detection). Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and was reverse transcripted using a First strand cDNA Synthesis Kit (TOYOBO, Osaka, Japan). The primers (Forward: 5′-GGAGGATCAAATGGCAGAACC-3′ and Reverse: 5′-GAAATGCGGAAGCCCACACAA-3′) were applied for detecting GnRH mRNA expression. Rat GAPDH was used as an internal control. The mRNA of GnRH relative to GAPDH levels was quantified with the 2^−ΔCt method, where ΔCt = Ct_{target gene} − Ct_GAPDH.

Total RNA was extracted from each wheat sample using a Hipure Plant RNA Mini Kit (Magen, Guangzhou, China), according to the manufacturer’s instructions, and stored at −80 °C until use. The first-strand cDNA was synthesized from 1 μg total RNA per 20 μL reaction volume using a First Strand cDNA Synthesis Kit (Toyobo, Kita-ku, Osaka, Japan), according to the manufacturer’s instructions, and as previously described [37 (link)]. The real-time quantitative polymerase chain reaction (RT-qPCR) assay was conducted on an ABI7900HT Sequence Detection System (Applied Biosystems QuantStudio 5, Foster City, CA, USA) using the Hieff qPCR SYBR Green Master Mix (Yeasen, Shanghai, China). At least 3 biological replicates, with 3 technical replicates, were used for each treatment. The relative gene expression levels were calculated according to the 2^−ΔΔC(t) method [38 (link)]. In each reaction, the Triticum aestivum cell division cycle (CDC) gene was used as an internal reference gene [35 (link)]. All primers used in RT-qPCR are listed in Table S1.

Total RNA was extracted from dorsal spinal cord of each group by using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Subsequently, cDNA was synthesized from 900 ng of total RNA using a First Strand cDNA Synthesis Kit (TOYOBO, Osaka, Japan). The primer sequences of IL-6, JAK2, STAT3 and GAPDH are shown in Table 1. RT-PCR was performed with Step One Plus™ Real-Time PCR System (Applied Biosystems, CA, USA) using SYBER Green RT-PCR kit (Takara Dalian, China). The mRNA of IL-6, JAK2 and STAT3 relative to GAPDH mRNA were quantified with the 2^−ΔCt method, where ΔCt = Ct _{target gene} - Ct _GAPDH.

N2a cells were transfected with siRNAs for Slc25a4 and collected for RNA isolation. RNA quality was assessed by using a NanoDrop 2000 (Thermo Scientific). The cDNAs were synthesized by ReverTra Ace qPCR RT MasterMix (Toyobo, FSQ-201) or First-Strand cDNA Synthesis Kit (Toyobo, FSK-101). qPCR was performed using SYBR Green Supermix (Bio-Rad, 172–5124).
The primer sets used in this study are listed here: β-actin-F: AGGTGACAGCATTGCTTCTG; β-actin-R: GCTGCCTCAACACCTCAAC; Slc25a4-F: TGATTGTGTCGTGAGAATCCCC; Slc25a4-R: AGAACTGCTTATGGCGATCCA.

Total RNA isolation and quantitative RT‐PCR amplification were performed as previously described.¹⁷ Briefly, complementary DNA (cDNA) synthesis was performed by using a first Strand cDNA Synthesis Kit (Toyobo, Ōsaka, Japan). cDNA was amplified using specific primers: ADAMTS5, Forward: 5′‐TATGACAAGTGCGGAGTATG‐3′, Reverse: 5′‐TTCAGGGCTAAATAGGCAGT‐3′; MMP3, Forward: 5′‐ATGCCCACTTTGATGATGATGAAC‐3′, Reverse: 5′‐CCACGCCTGAAGGAAGAGATG‐3′; MMP13, Forward: 5′‐GCTGGACTCCCTGTTG‐3′, Reverse: 5′‐TCGGAGCCTGTCAACT‐3′; GAPDH: Forward: 5′‐CTCCCACTCTTCCACCTTCG‐3′, Reverse: 5′‐TTGCTGTAGCCGTATTCATT‐3′;

Ten clinical samples (tonsils, lymph nodes and spleen) were collected from three pig farms in China (Hubei, Guangdong and Guangxi) in 2019. The RNA of clinical samples was isolated by using TRIzol reagent (Invitrogen, Carlsbad, California, USA) in accordance with the manufacturer’s instructions. RNA was then quantified and reverse-transcribed by using a First Strand cDNA Synthesis Kit (TOYOBO, Osaka City, Osaka Prefecture, Japan) in accordance with the manufacturer’s instructions. All samples were amplified by reverse transcription-polymerase chain reaction (RT-PCR) by using previously described specific primers, which were used for the CSFV E2 full-sequence gene [5 (link)]. The amplified gene segments were then ligated into a pEASY^®-blunt cloning vector (Transgen Biotech, Beijing, China). Positive clones were sequenced by using Sanger Sequencing Technology and submitted to NCBI (GenBank accession number: MT422346, MT422347, MT422348).