Dimethyl sulfoxide, hydroxylamine·hydrochloride, phenylmethane sulfonylfluoride, thiobarbituric acid, metaphosphoric acid, o-phthaldialdehyde, bovine serum albumin, HEPES, digitonin, 2′,7′-dichlorofluorescein diacetate (DCF-DA), tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbo-cyanine iodide (JC-1), iron (III) chloride hexahydrate, egtazic acid (EGTA), malate, pyruvate, phosphoric acid, metaphosphoric acid, protease inhibitor, polyvinylidene difluoride (PVDF) membrane, Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum, penicillin, streptomycin, 2′,3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), and solvents were purchased from Millipore (Billerica, MA, USA). A superoxide dismutase (SOD) determination kit was purchased from Dojindo Molecular Technologies (Kumamoto, Japan). An ATP bioluminescence assay kit was purchased from Promega Corp. (Madison, WI, USA). PM2.5 (mean diameter: 1.06 μm) was purchased from Power Technology INC. (Arizona Test Dust (ATD), Arden Hills, MN, USA). The components of PM2.5 are presented in Table 1 .
2 7 dichlorofluorescein diacetate dcf da
Manufactured by Merck Group
Sourced in United States, Germany, United Kingdom
2′,7′-dichlorofluorescein diacetate (DCF-DA) is a fluorogenic compound that is commonly used as a molecular probe in cell-based assays. It is a non-fluorescent molecule that becomes fluorescent upon hydrolysis and oxidation within cells, making it useful for measuring intracellular oxidative stress and reactive oxygen species (ROS) levels.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (17 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (8 mentions)
Propidium iodide, by Merck Group (8 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (7 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (6 mentions)
Bovine serum albumin (bsa), by Merck Group (5 mentions)
Penicillin, by Thermo Fisher Scientific (5 mentions)
Streptomycin, by Thermo Fisher Scientific (5 mentions)
Digitonin, by Merck Group (4 mentions)
Metaphosphoric acid, by Merck Group (4 mentions)
Penicillin, by Merck Group (4 mentions)
Bcl 2, by Santa Cruz Biotechnology (4 mentions)
Crystal violet, by Merck Group (4 mentions)
Hoechst 33342, by Thermo Fisher Scientific (4 mentions)
Opti mem, by Thermo Fisher Scientific (4 mentions)
Protease inhibitor, by Merck Group (3 mentions)
Hepes, by Merck Group (3 mentions)
Fetal bovine serum (fbs), by Merck Group (3 mentions)
Streptomycin, by Merck Group (3 mentions)
Thiobarbituric acid, by Merck Group (3 mentions)
109 protocols using 2 7 dichlorofluorescein diacetate dcf da
1
Characterization of PM2.5-Induced Oxidative Stress
2
Oxidative Stress Measurement Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hydroxylamine·hydrochloride, phenylmethane sulfonylfluoride, thiobarbituric acid (TBA), metaphosphoric acid, o-phthaldialdehyde, bovine serum albumin (BSA), HEPES, digitonin, 2′,7′-dichlorofluorescein diacetate (DCF-DA), tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbo-cyanine iodide (JC-1), polyvinylidene difluoride, iron (III) chloride hexahydrate, protease inhibitor (PI), and polyvinylidene difluoride (PVDF) membrane were purchased from Millipore (Billerica, MA, USA). Superoxide dismutase (SOD) determination kit was purchased from Dojindo Molecular Technologies (Kumamoto, Japan). Primary antibody information is presented in Table S1 . Secondary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA).
3
Amyloid Beta Induced Neurodegeneration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amyloid beta (Aβ)1–42, hydroxylamine hydrochloride, sodium hydroxide, hydrochloride, ferric (III) chloride hexahydrate, metaphosphoric acid, o-phthaldialdehyde, phosphoric acid, thiobarbituric acid (TBA), mannitol, sucrose, bovine serum albumin (BSA), HEPES sodium salt, 3,12-bis(carboxymethyl)-6,9-dioxa-3,12-diazatetradecanedioic acid (EGTA), 2′,7′-dichlorofluorescein diacetate (DCF-DA), digitonin, potassium chloride, potassium phosphate, HEPES, magnesium chloride, pyruvic acid, malic acid, JC-1, protease inhibitor, polyvinylidene difluoride (PVDF) membrane, sodium azide and all other chemicals were purchased from Millipore (Billerica, MA, USA). Primary antibodies such as phosphorylated c-Jun N terminal kinase (p-JNK) (sc-6254), glycogen synthase kinase 3 beta (GSK3β) (sc-9166), phosphorylated-tau (p-tau) (sc-12952), cytochrome C (sc-13560), caspase 3 (sc-56053) and β-actin (sc-69879) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Other primary antibodies such as tumor necrosis factor-alpha (TNF-α) (3707S), phosphorylated-nuclear factor kappa-light-chain-enhanced of activated B cells (p-NF-κB) (#3031), phosphorylated-protein kinase (p-Akt) (#9271), BAX (#2772) and secondary antibodies such as anti-rabbit (7074S) and anti-mouse (7076S) were purchased from Cell Signaling Technology (Danvers, MA, USA).
4
ROS Production Assay in HepG2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ROS production was measured using the fluorogenic probe 2',7'-dichlorofluorescein diacetate (DCF-DA) (Sigma) as described previously (Korashy and El-Kadi 2012) (link). Briefly, HepG2 cells were seeded in dark 96 well plate and incubated with the B[a]P (0-50 nM) for 24 hours. In protection experiment, cells were exposed to B[a]P 50 nM or co-exposed to either BC, BA8C, retinol or RA (1, 5, 10 or 20 nM). The cells were then stained with DCF-DA (5 µM) for 1 hour at 37°C. The fluorescence intensity was measured at excitation and emission wavelengths of 485 and 535 nm, respectively, using a 96-well plate reader (Baxter, Deerfield, IL). Each treatment was represented by five wells. Each experiment was repeated twice to confirm replication of the obtained results.
5
Oxidative Stress Induction in MB49 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MB49 cells were seeded in 96-well black wall plates
(Corning, NY, USA) at a concentration of 1 × 105 cells/well
and exposed to a complete medium with Ti(OH)4 activated
for 1 h with visible light. A solution of 10 μmol/L of H2O2 was used (30 min of exposure) as a positive
control to induce oxidative stress in the cells. Cells without any
treatment were used as a negative control. After the exposure period,
the cells were washed with PBS (1×) and labeled with 30 μL
of a 100 μmol/L solution of 2′,7′-dichlorofluorescein
diacetate (DCF-DA) (Sigma-Aldrich, USA). Fluorescence readings were
taken using the Spectra Max i3 (Molecular Devices) with 485–530
nm excitation.74 (link)
(Corning, NY, USA) at a concentration of 1 × 105 cells/well
and exposed to a complete medium with Ti(OH)4 activated
for 1 h with visible light. A solution of 10 μmol/L of H2O2 was used (30 min of exposure) as a positive
control to induce oxidative stress in the cells. Cells without any
treatment were used as a negative control. After the exposure period,
the cells were washed with PBS (1×) and labeled with 30 μL
of a 100 μmol/L solution of 2′,7′-dichlorofluorescein
diacetate (DCF-DA) (Sigma-Aldrich, USA). Fluorescence readings were
taken using the Spectra Max i3 (Molecular Devices) with 485–530
nm excitation.74 (link)
6
Ferroptosis Pathway Modulation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DMEM medium, fetal calf serum and HEPES were purchased from Gibco BRL (Grand Island, NY). Erastin, 2′,7′-dichlorofluorescein diacetate (DCF-DA), annexin V, propidium iodide (PI), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium-bromide (MTT), Hoechst 33258, calcein-AM, penicillin and streptomycin were purchased from Sigma (St. Louis, MO). The salicylaldehyde isonicotinoyl hydrazone (SIH) was synthesized as described previously (Shi et al., 2010 (link)). The anti-mouse FtMt polyclonal antibody and anti-human FtMt monoclonal antibody were gifts from Prof. Sonia Levi. Anti-human β-actin polyclonal antibody (sc-130656, 1:3000 dilution), anti-human monoclonal L-ferritin antibody (sc-390558, 1:1000 dilution), anti-human VDAC2 polyclonal antibody (sc-32059, 1:1000 dilution) and anti-human NOX2 monoclonal antibody (sc-74514, 1:1000 dilution) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-human VDAC3 antibody (14451-1-AP, 1:500 dilution) was purchased from ProteinTech Group, Inc. (Chicago, IL). The anti-human polyclonal TfR1 antibody (PA5-27739, 1:2000 dilution) was purchased from Invitrogin (Shanghai, China).
7
Lipid-Based Nanoparticle Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lipids (DOTAP: catalog no. 890890; DOPC: catalog no. 850375) were purchased from Avanti Polar Lipids. DMEM (catalog no. 11965-092), fetal bovine serum (FBS; catalog no. 10437-028), trypsin (catalog no. 15400054), LysoTracker (catalog no. L7528), Hoechst 33342 (catalog no. H3570), PBS (catalog no. 10010023) solution, Hank’s balanced salt solution (HBSS; catalog no. 14175145), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; catalog no. 14185052) buffer, and Opti-MEM (catalog no. 31985070) solution were purchased from Thermo Fisher. Uranyl acetate (catalog no. 73943), paraformaldehyde (catalog no. P6148), chloroform (catalog no. 372978), Fluoromount aqueous mounting medium (catalog no. F4680), and 2′, 7′-dichlorofluorescein diacetate (DCF-DA) (catalog no. D6883) were purchased from Sigma-Aldrich. asODN with 3′ end modified by 6-carboxyfluorescein (FAM) was purchased from IDT Tech. We used the sequence 5′TGGTGCTTCCCAGCCACTAT3′-6-FAM. Goat anti-PAC1R primary antibody (catalog no. sczsc-15964) and donkey anti-goat IgG-FITC secondary antibody (catalog no. sczsc-2024) were purchased from Santa Cruz Biotechnology. PACAP-27 (catalog no. 05-23-2151) and PACAP-38 (catalog no. 05-23-2150) were purchased from Merck Millipore Pty.
8
Carnosol Induces Autophagy and Apoptosis in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human breast cancer cells MDA-MB-231 were maintained in Dulbecco Minimal Essential Medium (DMEM) (Hyclone, Cramlington, UK). All media were complemented with 10% fetal bovine serum (FBS) (Hyclone, Cramlington, UK), 100 U/ml penicillin/streptomycin (Hyclone, Cramlington, UK). Carnosol, 2′,7′–dichlorofluorescein diacetate (DCFDA) and tiron were obtained from Sigma Aldrich. Antibodies to p62/SQSTMI were obtained from Abcam (Abcam, Cambridge, UK). Antibodies to LC3, cleaved caspase 3, caspase 8, Bax, Bcl2, p27, and pErk1/2(Th202/Th204), were obtained from Cell Signaling. Antibodies to caspase 9, γH2AX, p21 (WAFA/Cip1), (ser10) histone H3, acetyl histone H3, acetyl histone H4 were obtained from Millipore (Millipore, Hayward, CA, USA). Antibodies to β-actin, pSTAT3 were obtained from Santa Cruz Biotechnology, Inc. Anti-Poly (ADP-ribose) polymerase (PARP) antibody was obtained from BD Pharmingen. Beclin-1 siRNA was purchased from Cell Signaling.
9
Oxidative Stress and Antioxidant Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1-phenyl-2-thiourea (PTU), 1-Chloro-2,4-dinitrobenzene (CNDB), 2′,7′-dichlorofluorescein diacetate (DCF-DA), acridine orange, calcium chloride, nitroblue tetrazolium chloride (NBT), dimethyl sulfoxide (DMSO), dibasic potassium phosphate, monobasic potassium phosphate, riboflavin, and tricaine were purchased from Sigma (Darmstadt, Germany). Hydrogen peroxide (H2O2) and methionine were purchased from Synth. Ethylenediaminetetraacetic acid (EDTA) was purchased from Vetec (Duque de Caxias, Brazil). Ethyl alcohol, potassium chloride, sodium chloride, magnesium sulfate, and Sudan black were purchased from Êxodo Científica (Sumaré, Brazil). Bradford reagent was purchased from Perfyl Tech (São Bernardo do Campo, Brazil).
10
Cytotoxicity of Chemotherapy Agents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemicals were of analytic grade and obtained from Sigma-Aldrich (St Louis, USA).
Cyclophosphamide (monohydrate salt), ifosfamide, acrolein, chloroacetaldehyde, resazurin salt, 2′,7′-dichlorofluorescein diacetate (DCF-DA) and salts for Krebs-bicarbonate solution were purchased from Sigma-Aldrich (St Louis, USA). This is a post-peer-review, pre-copyedit version of an article published in Archives of Toxicology.
The final authenticated version is available online at: http://dx.doi.org/10.1007/s00204-019-02589-1.
Cyclophosphamide (monohydrate salt), ifosfamide, acrolein, chloroacetaldehyde, resazurin salt, 2′,7′-dichlorofluorescein diacetate (DCF-DA) and salts for Krebs-bicarbonate solution were purchased from Sigma-Aldrich (St Louis, USA). This is a post-peer-review, pre-copyedit version of an article published in Archives of Toxicology.
The final authenticated version is available online at: http://dx.doi.org/10.1007/s00204-019-02589-1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!