4d nucleofector system

Manufactured by Lonza

Sourced in Switzerland, United States, Germany, France

The 4D-Nucleofector system is a transfection device used for the delivery of nucleic acids, such as DNA and RNA, into a variety of cell types. It utilizes a specialized electroporation technology to facilitate the efficient introduction of these molecules into the target cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

4D-Nucleofector (470 citations) Nucleofector system (80 citations) Amaxa 4D-Nucleofector system (45 citations) 4D-Nucleofector X Unit system (5 citations) 4D-Nucleofector System N (3 citations) 4D X Nucleofector system (3 citations)

284 protocols using 4d nucleofector system

Manipulation of BCL Family Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stock solutions (10 mM) of trametinib, ABT-199, ABT-263, AT-101, sabutoclax, and UMI-77 (Selleckchem, Houston, TX, USA) were prepared in DMSO and stored at −80 °C. Appropriate concentrations of each drug were prepared in DMSO prior to use. Cell lines were transfected with siRNAs to BCL-2 (ON-TARGETplus Human BCL2 SMARTpool; Dharmacon, Lafayette, CO, USA), BCL-XL (Hs_BCL2L1_2, QIAGEN, Hilden, Germany), MCL-1 (Hs_MCL1_6, QIAGEN), BIM (Hs_BCL2L11_5, QIAGEN), and BAD (Hs_BAD_3, QIAGEN) using 4D-Nucleofector system (Lonza, Basel, Switzerland). AllStars Negative Control siRNA (QIAGEN) was the negative control.
The BIM-GFP expression plasmid was constructed by cloning the human BIM_EL cDNA (BCL2L11-001, ENST00000393256) into a pMCEF vector and moving the BamHI and AgeI restriction fragment into the pEGFP-N1 vector. The plasmid was transfected into SD1 cells using 4D-Nucleofector system (Lonza) and GFP⁺ cells were sorted by flow cytometry after 48 h.

Korfi K., Smith M., Swan J., Somervaille T.C., Dhomen N, & Marais R. (2016). BIM mediates synergistic killing of B-cell acute lymphoblastic leukemia cells by BCL-2 and MEK inhibitors. Cell Death & Disease, 7(4), e2177-.

+ Open protocol

+ Expand

Optimized Electroporation and AAV Transduction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electroporation conditions were optimized by electroporating 1 μg of GFP mRNA with the 4D-Nucleofector system (Lonza, Switzerland) using established Amaxa electroporation codes for human keratinocytes and the Neon system (Invitrogen) with a 1,700-V/20-ms/1-pulse configuration. Sg2 gRNA¹ (link) is a chemically modified sgRNA (Synthego, Redwood City, CA, USA) complementary to the DNA sequence 5′-CCTGCAGACCCTACATAGAG-3′.¹¹ (link) 1.6 μg of sgRNA mixed with 6 μg of Cas9 protein (Integrated DNA Technologies, IA, USA) was delivered to 1 × 10⁵ primary keratinocytes in Opti-MEM medium (Thermo Fisher Scientific). The electroporation platform used for delivery of the RNPs was the 4D-Nucleofector system (Lonza, Switzerland), electroporation code CM137.
After electroporation, cells were transduced in suspension for 1 h with the AAV vectors at an MOI of 30,000 in a final volume of 50 μL of Opti-MEM medium (Thermo Fisher Scientific). Cells were then plated onto feeder layer-containing plates. For MSCs and CD34⁺ cells, 3.2 μg of sgRNA and 6 μg of Cas9 were used. The Amaxa electroporation codes were CM119 and DZ100 for MSCs and CD34⁺ cells, respectively. For viral transduction, MSCs were incubated with the AAV6 vectors for 15 min in suspension and then plated in culture medium. For CD34⁺ cell transduction, AAV6 was added directly to the well.

Bonafont J., Mencía A., Chacón-Solano E., Srifa W., Vaidyanathan S., Romano R., Garcia M., Hervás-Salcedo R., Ugalde L., Duarte B., Porteus M.H., Del Rio M., Larcher F, & Murillas R. (2021). Correction of recessive dystrophic epidermolysis bullosa by homology-directed repair-mediated genome editing. Molecular Therapy, 29(6), 2008-2018.

+ Open protocol

+ Expand

Overexpression of Topoisomerase IIβ in hMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To transfect the hMSC line with topo IIβ gene, 4D Nucleofector™ system (Lonza) was used; 5 × 10⁵ cells of the hMSC line were transfected with five different concentrations of topo IIβ plasmid (4, 5, 6, 8, and 10 μg) using the 4D Nucleofector™ system (Lonza). hMSCs were detached by 0.25% Trypsin/EDTA (Gibco) and resuspended in a total of 100 μl of solution, including 82 μl nucleofector solution and 18 μl supplement. Topo IIβ plasmid (4, 5, 6, 8, and 10 μg) were added to each 100 μl solution and transferred into nucleocuvettes, respectively. The FF-104 (high-efficiency) program was applied. After nucleofection, cells were resuspended in 500 μl prewarmed RPMI containing 10% FBS and incubated at 37 °C for 10 min as a recovery step. The transfected hMSC line was seeded into culture dishes containing the DMEM-LG and 10% FBS and incubated at 37 °C in a 5% CO₂ incubator. The medium was refreshed 24 h after nucleofection. Total RNA was extracted and the efficiency of overexpression was measured by RT-qPCR (Corbett Life Science).

Zaim M, & Isik S. (2018). DNA topoisomerase IIβ stimulates neurite outgrowth in neural differentiated human mesenchymal stem cells through regulation of Rho-GTPases (RhoA/Rock2 pathway) and Nurr1 expression. Stem Cell Research & Therapy, 9, 114.

+ Open protocol

+ Expand

Generation and Characterization of PAX5 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

5 × 10⁵~2 × 10⁶ Raji cells in good condition were collected and suspended with matched solution supplemented with 5 μg CRISPR/CAS9 plasmid. Electrotransfection was performed with optimized program on LONZA 4D Nucleofector System (Lonza, Switzerland). Cells were cultured for 48 h and then sorted with Beckman MoFlo XDP (Beckman Coulter, Inc., USA), aiming to select cells with high GFP expression. The sorted cells were seeded in 96-well plates in the manner of single cell. Two or three weeks later, cells were collected for identification. Genomic DNA was isolated using the DNA Isolation Kit (BioTeke Corporation, Beijing, China) according to the manufacturer's instructions. PCR was used to amplify the PAX5 gene for mutation analysis. The PCR primers, synthesized by Sangon Biotech (Shanghai, China), were as follows: forward primer CTTCAGAAGAGGCACTTGAAGC and reverse primer TTACCAGGTTCAGCCCTTGG. The PCR product was reclaimed for sequence determination. The sequencing results were compared with the published PAX5 gene sequence to determine the presence of pax5+/− variants.

Gu J., Li T., Zhao L., Liang X., Fu X., Wang J., Shang Z., Huang W, & Zhou J. (2017). Identification of Significant Pathways Induced by PAX5 Haploinsufficiency Based on Protein-Protein Interaction Networks and Cluster Analysis in Raji Cell Line. BioMed Research International, 2017, 5326370.

+ Open protocol

+ Expand

IKAROS knockdown in naive CD4+ T cells

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Naive CD4⁺ T cells were isolated from PBMC using EasySep human Naive CD4⁺ T cell Enrichment Kit (STEMCELL Technologies, #19555). Two million cells were transfected with IKAROS siRNA smart pool (Dharmacon: L-019092-02-0005) or control siRNA (Dharmacon: D-001810-10-05) using P3 Primary cell 4D-Nucleofector Kit and the Lonza 4D-Nucleofector System (Lonza). Transfected cells were cultured for 48 h. Libraries were generated as recently described^{65 (link)} and sequenced using the Novogene Hiseq platform (Novogene). The fastq files generated from the sequencing runs were analyzed using the nf-core pipeline^{66 (link)} to determine read counts mapped to genes in GRCh37 genome. The data were further analyzed using Bioconductor packages edgeR and conditional quantile normalization. The experimental design was modeled upon donor and condition (control/knockdown) (~donor + condition). The downstream analysis to identify differentially expressed genes was performed as described in Chen et al.^{67 (link)} with the addition of offsets from conditional quantile normalization^{68 (link)}, followed by the application of gene-wise negative binomial generalized linear models^{69 (link)}.

Ye Z., Shen Y., Jin K., Qiu J., Hu B., Jadhav R.R., Sheth K., Weyand C.M, & Goronzy J.J. (2021). Arachidonic acid-regulated calcium signaling in T cells from patients with rheumatoid arthritis promotes synovial inflammation. Nature Communications, 12, 907.

+ Open protocol

+ Expand

EBV-Positive and Negative B-Cell Line Maintenance

Check if the same lab product or an alternative is used in the 5 most similar protocols

EBV positive cell line B95.8 was purchased from ATCC and EBV-transformed primary B cell line LCL1 was kindly provided by Xiaozhen Liang from Shanghai Pasteur Institute of CAS. All the EBV positive and negative (DG75, stored in the lab) B-lymphoma cells were maintained in RPIM1640 (Hyclone) medium with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Gibco-BRL). 293T cells were maintained in DMEM medium supplemented with 10% FBS) and 1% penicillin and streptomycin (Gibco-BRL). All cell lines were incubated at 37°C in a humidified environmental incubator with 5% CO2. For transfection, 293T cells were cultured for 24 h before transfection with cell confluence reaching 60–70%, and then transfected with plasmids DNA and polyethyleneimine (PEI) mixture at a ratio of 1μg DNA/3μl PEI (1mg/ml). DG75 cells transfection was performed with Lonza-4D nucleofector system in an optimized program, CA137.

Wang Y., Du S., Zhu C., Wang C., Yu N., Lin Z., Gan J., Guo Y., Huang X., He Y., Robertson E., Qu D., Wei F, & Cai Q. (2020). STUB1 is targeted by the SUMO-interacting motif of EBNA1 to maintain Epstein-Barr Virus latency. PLoS Pathogens, 16(3), e1008447.

+ Open protocol

+ Expand

THP-1 Cell Electrotransfection with FXR Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

THP-1 cells were electrotransfected with FXR plasmid DNA(2.5 μg/1 × 10⁶ cells) using a Mouse Macrophage Nucleofector Kit or Cell Line Nucleofector Kit V (Amaxa, Lonza) following the manufacturer’s instructions, LONZA 4D-Nucleofector System (Lonza, Germany) was used for transfection with the built-in program (code: FF-100). Cells were then transferred to a 6-well plate for immunoprecipitation analysis or to a poly-L-lysine coated glass bottom 24-well plate for immunofluorescence analysis.

Hao H., Cao L., Jiang C., Che Y., Zhang S., Takahashi S., Wang G, & Gonzalez F.J. (2017). Farnesoid X Receptor Regulation of the NLRP3 Inflammasome Underlies Cholestasis-Associated Sepsis. Cell metabolism, 25(4), 856-867.e5.

+ Open protocol

+ Expand

Electroporation of P. knowlesi Schizonts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Direct electroporation of P. knowlesi schizont-infected RBCs was performed as described by Janse et al. [15 (link)] and Moon et al. [9 (link)]. For each electroporation experiment, a total of 1 × 10⁷ or 3.5 × 10⁷ schizont-infected RBCs was purified by Percoll gradient from a 20 mL synchronized P. knowlesi culture (5% hct). The recovered cells (up to 50 μL) were suspended in 100 μL of P3 primary cell solution (Lonza, Basel, Switzerland) and mixed with 20 μg of plasmid DNA in 10 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). This suspension was transferred to a 4D Nucleofector XL cuvette and subjected to electroporation in the Lonza 4D Nucleofector System (Lonza), using program FP158. Immediately after electroporation, the suspension was placed into a 2 mL tube containing 500 μL of cRPMI and 300 μL of stock 50% hct rhesus RBCs. After 30 min at 37°C in a shaking incubator (250 rpm), the mixture (900 μL total) was transferred to a 25 cm² vented culture flask (Thermo Fisher, Waltham, MA, USA) with 5 mL of fresh cRPMI under a 90% N₂/5% CO₂/5% O₂ gas mixture. For drug selection experiments, an additional 200 μL of fresh 50% hct rhesus RBCs was added to cultures. Cells were collected 48 h later for luciferase assays or maintained in culture for selection under 1 nM WR99210 pressure (Fig. 1B).

Moraes Barros R.R., Gibson T.J., Kite W.A., Sá J.M, & Wellems T.E. (2017). Comparison of two methods for transformation of Plasmodium knowlesi: direct schizont electroporation and spontaneous plasmid uptake from plasmid-loaded red blood cells. Molecular and biochemical parasitology, 218, 16-22.

+ Open protocol

+ Expand

Nucleofection of Human PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleofection of PBMCs was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit (Lonza, Koln, Germany). Briefly, 10⁶ freshly isolated PBMCs were centrifuged and the cell pellet was resuspended in 20 ml of transfection buffer (P3 primary cell solution). Cells were then added with or without 1 μg of each plasmid of interest or with 0.4 mg of pmaxGFP vector as a positive control. Cells were transferred to a sterile Amaxa nucleofection cuvette (Nucleocuvette strips) and then electroporated using the Lonza 4D-Nucleofector system (program E0–115 for human T lymphocytes). Nucleofected cells were provided with 80 ml prewarmed sterile culture medium and transferred to a well of a sterile 24-well plate containing 900 ml of prewarmed sterile culture medium. Cells were then incubated at 37°C in a humid incubator with 5% of CO₂. After 6 hours of cell culture, 600 μl of medium was removed and replaced by a new culture medium. A proportion of the nucleofected cells were then transferred to 96-well plates for cell proliferation assays. Transfection efficiency of GFP nucleofected cells was analyzed at 24 hours by flow cytometry (FACS Canto II, Becton Dickinson). Cell viability was analyzed by using Trypan Blue.

Tlili A., Marzouki S., Chabaane E., Abdeladhim M., Kammoun-Rebai W., Sakkouhi R., Belhadj Hmida N., Oliveira F., Kamhawi S., Louzir H., Valenzuela J.G, & Ahmed M.B. (2017). Phlebotomus papatasi Yellow-Related and Apyrase Salivary Proteins Are Candidates for Vaccination against Human Cutaneous Leishmaniasis. The Journal of investigative dermatology, 138(3), 598-606.

+ Open protocol

+ Expand

Investigating YY1 Transcriptional Regulation in Naive CD4+ T Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Naïve CD4 T cells were isolated from PBMC using EasySep Human Naive CD4⁺ T cell Enrichment Kit (STEMCELL Technologies, Cat. # 19555). One million cells were transfected with control siRNA (Dharmacon, D-001910-01) or YY1 siRNA (Dharmacon, A-011796-16) using the P3 Primary cell 4D-Nucleofector Kit and the Lonza 4D-Nucleofector System (Lonza). Transfected cells were cultured in RPMI-1640 media supplemented with 10% fetal bovine serum (FBS) for 48 h until collection. Libraries were prepared using the NuGEN Ovation Whole Blood Kit according to the manufacturer’s instructions and sequenced on an Illumina 2500 HiSeq.
RNA-sequencing (RNA-seq) reads were aligned to hg19 using STAR 2.5.3a aligner⁶², followed by generation of transcript-level counts using featureCounts^{63 (link)} package. Normalization and identification of differentially enriched genes was performed using edgeR^{64 (link),65 (link)} and limma packages from R Bioconductor and modeled to identify differences in paired samples in control and YY1-knockdown groups.

Ye Z., Li G., Kim C., Hu B., Jadhav R.R., Weyand C.M, & Goronzy J.J. (2018). Regulation of miR-181a expression in T cell aging. Nature Communications, 9, 3060.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!