The largest database of trusted experimental protocols

Mirna mimic

Manufactured by GenePharma
Sourced in China, United States

MiRNA mimics are synthetic RNA molecules designed to mimic the structure and function of naturally occurring microRNAs (miRNAs). They are used in experimental and research settings to study the biological roles and effects of specific miRNAs in cellular processes.

Automatically generated - may contain errors

155 protocols using mirna mimic

1

Transfecting 293T Cells with miRNA Mimics

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells were plated at a cellular density of 1 × 106 per well on 100-mm culture dishes and cultured overnight. The cells were then transfected with double-stranded RNA oligos comprising the mature miRNA (miRNA mimic), RNA oligonucleotides complementary to mature miRNA (anti-miRNA) or negative controls (miRNA mimic, anti-miRNA negative control; GenePharma Co., Ltd, Shanghai, China) at a final concentration of 100 nM with the use of Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA). At 48 hrs after transfection, cellular lysates were collected for RNA or protein isolation. The transfection efficiency was ∽80%, as measured by the uptake of a FAM-labelled negative control.
+ Open protocol
+ Expand
2

Dual-Luciferase Assay for miRNA Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiRNA mimics and NC mimics (2′-O-methyl oligonucleotides) were synthesized chemically by Genepharma (Shanghai, China), the miRNA target binding site fragments were inserted into the multiple cloning sites of pmirGLO vector dual-luciferase report system (Promega, USA). HEK293T cells were cultured in 10% fetal bovine serum in DMEM (Gibco, USA), 800 nanograms of recombinant plasmid and 20 pmol MiRNA mimics (GenePharma, China) were co-transfected into HEK293T cells by Lipofectamine 2000 (Invitrogen, USA) in 24-well plates. Firefly and renilla luciferase activity were measured after 24 h transfection by the dual luciferase assay system (Promega, USA).
+ Open protocol
+ Expand
3

miR-31 Regulation of CHON-001 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For cell transfection, 5×104 CHON-001 cells/well were seeded into a 24-well plate. miRNA mimic and inhibitor were obtained from Shanghai GenePharma Co., Ltd., (Shanghai, China). The next day, cells were transfected with 50 nM miR-31 mimic (forward: 5′AGGCAAGAUGCUGGCAUAGCU3′, reverse: 5′CUAUGCCAGCAUCUUGCCUUU3′), 50 nM miR-31 inhibitor (5′AGCUAUGCCAGCAUCUUGCCU3′), miR-control (forward: 5′UUCUCCGAACGUGUCACGUTT3′, reverse: 5′ACGUGACACGUUCGGAGAATT3′), 2 µl control plasmid (cat. no. sc-108083; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), 2 µl CXCL12-plasmid (cat. no. sc-422854-ACT; Santa Cruz Biotechnology, Inc.), miR-31 mimic + control plasmid or miR-31 mimic+CXCL12-plasmid using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.). After 48 h, the cells were harvested for subsequent experimentation.
+ Open protocol
+ Expand
4

miR-15/107 Overexpression Impacts Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols
SW982 cells were cultured in DMEM high glucose medium (Hyclone, USA) supplemented with 10% FBS (Hyclone, USA) and 0.2% penicillin/streptomycin. Gain of miR-15/107 function was achieved by transfecting 10 nM miRNA mimic (Genepharma company, China) with Lipofectamine 3000 reagent (Invitrogen, USA) according to the manufacturer’s instruction. The scramble miRNA mimic served as negative control (NC). 48 h after cell transfection, CCK8 reagent was applied to the cells and incubated at 37 °C for 1 h. Optical density value was measured at 450 nm. The data was further normalized as percentage against NC group. Results for cell proliferation assay are represented as the mean ± SEM from the three independent cell experiments. Mann-Whitney test was used to analyze the statistical difference between the indicated group and NC group. P value less than 0.05 was considered as statistically significant.
+ Open protocol
+ Expand
5

Transfection of miRNA Mimic and siRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with the miRNA mimic (40 nM), siRNAs (80 nM) specific for hub genes or their corresponding negative controls (GenePharma, Shanghai, China) using a Lipofectamine 3000 kit (Thermo Fisher Scientific, Waltham, MA, United States) following the manufacturer’s instructions. The sequences of the siRNAs are shown in Supplementary Table S3.
+ Open protocol
+ Expand
6

Culturing and Transfecting Human Lung and Kidney Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human fetal lung fibroblast (HFL1) cells and human embryonic kidney (HEK293T) cells were purchased from the Cell Resource Center of Shanghai Institutes for Life Sciences, Chinese Academy of Sciences. The HFL1 and HEK293T cells were cultured in F12K and DMEM medium containing a mixture of 10% FBS and 1% penicillin-streptomycin, respectively, and placed in a 37 °C incubator containing 5% CO2. The growth of HFL1 cells was observed for a fixed period.
Information on the plasmids, siRNA, miRNA mimic, and probe sequence is provided in Supplementary Table S1. All plasmids, miRNA mimics, and siRNA were transfected with liposome 8000 (Beyotime Biotechnology, Beijing). pcDNA 3.1 (+) circSPON1 Mini, si-circSPON1, and miRNA mimic were synthesized by GenePharma. The administration doses for intracellular plasmid and siRNA transfection were according to Lipo 8000 instructions.
+ Open protocol
+ Expand
7

RNA Oligo Transfection and PRRSV Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA oligos including miRNA inhibitor, miRNA mimic, and siRNA were synthesized by Genepharma (Suzhou, China). The RNA oligo sequences are listed in Table S1. The miRNA mimic (at a concentration of 50 nM), miRNA inhibitor (50 nM), siRNA (100 nM), and the corresponding negative control were transfected into target cells for 24 h using lipofectamine RNAiMAX reagent (Invitrogen, USA) according to the manufacturer’s instructions.
After all the different indicated treatments, cell monolayers were inoculated with HP-PRRSV HuN4 at an MOI of 0.1 unless otherwise stated. After 60 min of incubation, cell monolayers were washed and then further incubated in fresh culture media for an additional 24 h or indicated time points. The cells and supernatants were then collected for qPCR and virus titer determination separately.
+ Open protocol
+ Expand
8

Transfection of miRNA, siRNA in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The transfections of miRNA mimic, miRNA inhibitor, siRNA, and their corresponding control (GenePharma) were carried out with Hiperfect transfection reagent (Qiagen) following the manufacturer's instructions. The detail sequences were shown in Supplementary Table S2, Supplementary Table S3.
+ Open protocol
+ Expand
9

Investigating circMYBL2 Expression in Liver Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ATCC provided all cell lines (LO2, MHCC-97H, LM3, HepG2 and Huh-7) for this study. The cells were cultured under standard conditions in DMEM (Corning, NY, USA) and confirmed to be mycoplasma-free. A circMYBL2 overexpression vector was constructed by Hanheng Biotech (Shanghai, China). The construct used for RNAi-mediated knockdown of circMYBL2, the miRNA mimic, and the miRNA inhibitor were synthesized by GenePharma (Shanghai, China). Transfection of cells was carried out by Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA).
+ Open protocol
+ Expand
10

Downregulation of PPARγ and VEGF-A by miR-130b

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-130b inhibitor (anti-M), miR-130b mimic, or the appropriate negative controls of miRNA inhibitor (anti-MC) and miRNA mimic were purchased from GenePharma (Shanghai, China). Anti-M and anti-MC were transfected at a final concentration of 50–100 nM in the cells using HiPerFect Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. Expression of PPARγ and VEGF-A were knocked down with small interfering RNA (siRNA) duplexes using Oligofectamine (Invitrogen, Carlsbad, CA). The target sequences for PPARγ and VEGF-A mRNA were shown in Table 2. Non-targeting siRNA pool (D-001206-13-05; Dharmacon, Fisher Scientific, Pittsburgh, PA) was used as a negative control. Cells were harvested 72 hours post transfection for analysis.

Target sequences for PPARγ and VEGF-A mRNA

GenesTarget sequences
PPARγ5’-AAUAUGACCUGAAGCUCCAAGAAUAAG-3’
VEGF-A5’-TGCTGTGAAGATGTACTCTATCTCGTGTTTTGGCCACTGACTGACACGAGATAGTACATCTTCA-3’
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!