Liver samples from mice were flash frozen in liquid nitrogen and stored at −80°C prior to RNA extraction. Livers were homogenized in Lysing Matrix D tubes (MP Biomedicals) containing 700 μl RLT buffer with 1% (v/v) β-mercaptoethanol (QIAGEN) using a FastPrep-24 (MP Biomedicals) bead beater for 45 s at 6.5 m/s (repeated 3 times, incubating on ice for 1 minute in between rounds). Homogenates were centrifuged at 20,000 × g at 4°C for 5 minutes to pellet debris, RNA was extracted using phenol:chloroform:IAA, pH 6.7 (Sigma), and samples were mixed with 50% ethanol prior to being transferred to QIAGEN RNeasy columns, according to the manufacturer’s instructions. Cleaned RNA samples were subjected to DNase treatment (Invitrogen) prior to cDNA synthesis using an iScript cDNA synthesis kit (Bio-Rad). RNA was removed through the addition of 1 N NaOH at 65°C for 30 minutes, followed by the addition of an equal volume of 1 N HCl. cDNA was cleaned using a PCR clean-up kit (Promega) according to the manufacturer’s instructions. cDNA concentrations were adjusted to 1 ng/μl using the Synergy 2 with Gen 5 software (Bio-Tek) prior to qRT-PCR using iQ SYBR Green mix (Bio-Rad), gene-specific primers (Table S1 ), and a CFX96 qPCR cycler (Bio-Rad). Transcript abundance was calculated using the ΔΔCt method and data were normalized to β-actin gene expression.
Cfx96 qpcr cycler
Manufactured by Bio-Rad
Sourced in United States
The CFX96 qPCR cycler is a real-time PCR detection system designed for quantitative PCR (qPCR) analysis. It features a 96-well format and can detect up to five fluorescent channels simultaneously. The system is capable of collecting fluorescence data during the PCR cycling process.
Automatically generated - may contain errors
Lab products found in correlation
Iq sybr green supermix, by Bio-Rad (9 mentions)
Random hexamer, by Promega (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Rnase inhibitor, by Promega (4 mentions)
Synergy 2 with gen 5, by Agilent Technologies (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Dnase removal reagent, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Turbo dna free dnase, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Dnase treatment, by Thermo Fisher Scientific (2 mentions)
Pcr clean up kit, by Promega (2 mentions)
Lysing matrix d tube, by MP Biomedicals (2 mentions)
Iq sybr green mix, by Bio-Rad (2 mentions)
Rneasy column, by Qiagen (2 mentions)
Fastprep 24, by MP Biomedicals (2 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Agpath id one step rt pcr reagent, by Thermo Fisher Scientific (1 mentions)
Cfx manager 2, by Bio-Rad (1 mentions)
17 protocols using cfx96 qpcr cycler
1
Quantitative RT-PCR Analysis of Liver Samples
2
Quantitative RT-PCR of Bacterial Genes
3
Quantitative PCR for Mycobacterium avium subsp. Paratuberculosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR of DNA extracted from tissue samples was performed as previously described with minor adjustments [26 ]. Briefly, reactions comprised 2 μL DNA sample, 12.5 μL Power SYBR green mastermix (Applied Biosystems, Paisley, UK), 2 pMoles primer pair (AV1: ATGTGGTTGCTGTGTTGGATGG, AV2: CCGCCGCAATCAACTCCAG), made to 25 μL with RNAse free water. PCR cycling used 95 °C: 15 min (1 cycle); at 95 °C: 30 s, 58 °C: 1 min, 72 °C: 1 min (40 cycles) with data collection at 76 °C (10 s) using a CFX96 qPCR cycler (BioRad, Hemel Hempstead, UK). Sample copy numbers were estimated from an averaged value of three qPCR’s on each sample using a dilution curve of a control total genomic DNA MAP K-10 stock preparation serially diluted 10 fold to contain between 1 × 102-108 genome equivalents. Nested MAP specific PCR of DNA extracted from PBMC and liquid pre-culture faecal sample preparations was performed as previously described [25 (link)].
4
Quantitative Detection of RusV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RusV-specific RNA was detected by TaqMan RT-qPCR using the AgPath-ID one-step RT-PCR reagents (Thermo Fisher Scientific, Germany) along with a modified primer/probe set targeting the p200 ORF (2 (link)). Briefly, 2.5 μL extracted RNA was reverse-transcribed and amplified in a reaction mix of 12.5 μL total volume containing primers RusV_1072_A+ (5′-CGAGCGYGTCTACAAGTTYA -3′; final concentration 0.8 μM) and RusV_1237− (5′-GACCATGATGTTGGCGAGG -3′; 0.8 μM) and probe RusV_1116_A_P (5′-[FAM]CCGAGGARGACGCCCTGTGC [BHQ1]-3′; 0.4 μM). The reaction was performed with the following cycler setup: 45°C for 10 min, 95°C for 10 min, 45 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 sec on a Bio-Rad CFX96 qPCR cycler (Bio-Rad, Germany).
5
Quantitative Analysis of Baculovirus DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was done as previously described[17 (link)]. For analysis of viral DNA replicated in transfected cells, Sf9 cells seeded in 35-mm plates were transfected with vAcac75ko-PH, vAcac75ko-rep-PH, or vAcPH were harvested at designated time points. The DNA was extracted by phenol-chloroform-isoamyl alcohol and precipitated with isopropanol. Each DNA pellet was dissolved in 80 μl of ddH2O. Seven point five microliters of DNA from each sample was treated with 4 units of Dpn I in a 10 μl of total reaction volume. One microliter of each Dpn I-digested DNA sample was used for each qPCR reaction.
The DNA purified from cells or supernatants from transfection was mixed with the SYBR-Green I Real-Time PCR Master Mix Kit (Toyobo) and the qPCR primers Q-65972F and Q-66072R [17 (link)] in a 20-μl reaction. The samples were analyzed in a Bio-Rad CFX96 qPCR cycler. The results were analyzed using CFX Manager 2.1 (Bio-Rad) software. The qPCR product corresponded to a 100-bp region of the AcMNPV gp41 gene. The number of viral DNA genome copies within each sample was calculated by using a standard curve generated from a dilution series of a plasmid containing AcMNPV gp41.
The DNA purified from cells or supernatants from transfection was mixed with the SYBR-Green I Real-Time PCR Master Mix Kit (Toyobo) and the qPCR primers Q-65972F and Q-66072R [17 (link)] in a 20-μl reaction. The samples were analyzed in a Bio-Rad CFX96 qPCR cycler. The results were analyzed using CFX Manager 2.1 (Bio-Rad) software. The qPCR product corresponded to a 100-bp region of the AcMNPV gp41 gene. The number of viral DNA genome copies within each sample was calculated by using a standard curve generated from a dilution series of a plasmid containing AcMNPV gp41.
6
Quantifying RNA Expression in Clostridioides difficile
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify RNA, C. difficile Table 1 ) was normalized to the rpoB housekeeping gene using the ΔΔCt method.
7
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of RNA was reverse transcribed by M-MLV reverse transcriptase (Fisher Scientific) in the presence of RNase inhibitor (Promega) and random hexamers (Promega). Newly synthesized cDNA was diluted 1:20 in water and used in reverse transcription-quantitative PCR (qRT-PCR) using iQ SYBR green supermix (Bio-Rad). Amplification was achieved using a 3-step melt curve program on a CFX96 qPCR cycler (Bio-Rad). Target gene expression was normalized to the rpoB housekeeping gene using the threshold cycle (ΔΔCT) method (for primers, see Table 2 and reference 68 (link)).
8
Quantitative Analysis of B. anthracis Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown at 30 °C in LB medium overnight and subcultured at a 1:100 ratio into fresh LB medium. After 6 h of growth at 37 °C in the presence or absence of TCS activator as specified, aliquots of 1 ml of cell culture were harvested by centrifugation. Total RNA was extracted using a RNeasy Mini Kit following the manufacturer’s instructions (Qiagen Sciences, Germantown, MD), and treated with Turbo-DNA-free DNase (Ambion). The DNase was removed using DNase removal reagents (Ambion). RNA samples were quantified using a NanoDrop spectrophotometer. Total RNA (200 ng) from each sample was subjected to cDNA synthesis using high-capacity cDNA reverse transcription kits (Applied Biosystems, Foster City, CA). Quantitative PCR (qPCR) was then conducted using iQ SYBR green supermix (Bio-Rad) on a CFX96 qPCR cycler (Bio-Rad). The B. anthracis housekeeping gene 16 S rRNA was used as an internal control.
9
Quantifying Microbial Nitrification Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA and total RNA of microbial biomass from the 0.2 µm filters were extracted using the DNeasy PowerSoil kit (Qiagen, Germany) and the RNeasy PowerWater kit (Qiagen, Germany), respectively, according to the manufacturer’s specifications. RNA was further processed with the TURBO DNA-free kit (Thermo Fischer Scientific, Germany) to remove remnant DNA in the samples before cDNA synthesis [38 (link)]. Reverse transcription was performed using the GoScript Reverse Transcription System (Promega, USA). Gene and transcript abundances of amoA from CMX Nitrospira, AOB, AOA and of nxrB from Nitrospira-like NOB were determined using a CFX96 qPCR cycler (Bio-Rad, USA). Primer pairs for quantification were comamoAF/ comamoAR for CMX amoA [11 (link)], AmoA-1F/ AmoA-2R for AOB amoA [39 (link)], Arch-amoAF/ Arch-amoAR for AOA amoA [40 (link)] and nxrB169f/ nxrB638r for Nitrospira-like nxrB [41 (link)]. More details are provided in the Supplementary Methods. For testing of potential correlations between CMX amoA and Nitrospira nxrB genes, we assumed on average one copy of amoA and 1.5 copies of nxrB per cell. Calculation of the correction factor 1.5 was based on the analysis of putative canonical Nitrospira-affiliated MAGs from the Hainich groundwater metagenome, which harbored 1 to 2 nxrB gene copies per genome [21 (link)].
10
Quantitative RT-PCR Analysis of Liver Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver samples from mice were flash frozen in liquid nitrogen and stored at −80°C prior to RNA extraction. Livers were homogenized in Lysing Matrix D tubes (MP Biomedicals) containing 700 μl RLT buffer with 1% (v/v) β-mercaptoethanol (QIAGEN) using a FastPrep-24 (MP Biomedicals) bead beater for 45 s at 6.5 m/s (repeated 3 times, incubating on ice for 1 minute in between rounds). Homogenates were centrifuged at 20,000 × g at 4°C for 5 minutes to pellet debris, RNA was extracted using phenol:chloroform:IAA, pH 6.7 (Sigma), and samples were mixed with 50% ethanol prior to being transferred to QIAGEN RNeasy columns, according to the manufacturer’s instructions. Cleaned RNA samples were subjected to DNase treatment (Invitrogen) prior to cDNA synthesis using an iScript cDNA synthesis kit (Bio-Rad). RNA was removed through the addition of 1 N NaOH at 65°C for 30 minutes, followed by the addition of an equal volume of 1 N HCl. cDNA was cleaned using a PCR clean-up kit (Promega) according to the manufacturer’s instructions. cDNA concentrations were adjusted to 1 ng/μl using the Synergy 2 with Gen 5 software (Bio-Tek) prior to qRT-PCR using iQ SYBR Green mix (Bio-Rad), gene-specific primers (Table S1 ), and a CFX96 qPCR cycler (Bio-Rad). Transcript abundance was calculated using the ΔΔCt method and data were normalized to β-actin gene expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!