pEGFP-N1 plasmid (Clontech, Mountain View, California, US) was transformed into XL1-Blue [dut+, ung+] (Stratagene, San Diego, California (CA), US) or CJ236 [dut-, ung-] (NEB) E. coli competent cells. Cell cultures were grown for 16 hr in Luria broth (LB) media supplemented with 50 µg/ml kanamycin at 37°C. Plasmids used in this study were purified using PureYield Plasmid Midiprep Kit (Promega, Madison, Wisconsin, US) according to the instructions of the manufacturer. XL1-Blue and CJ236 E. coli strains were propagated in LB media at 37°C and were harvested at log phase. Genomic DNA of bacterial samples as well as eukaryote cells was purified using the Quick-DNA Miniprep Plus Kit (Zymo Research, Irvine, California, US) using the recommendations of the manufacturer.
Pureyield plasmid midiprep kit
Manufactured by Promega
Sourced in United States, Netherlands
The PureYield Plasmid Midiprep Kit is a laboratory product designed to purify plasmid DNA from bacterial cultures. It employs a silica-based membrane technology to capture and elute the plasmid DNA. The kit provides a simple, efficient, and reliable method for isolating high-quality plasmid DNA suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Pegfp n1 plasmid, by Takara Bio (2 mentions)
Nanodrop 3300, by Thermo Fisher Scientific (2 mentions)
Purexpress kit, by New England Biolabs (2 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Quick dna miniprep plus kit, by Zymo Research (1 mentions)
Nextseq sequencing, by Illumina (1 mentions)
Quickchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
Hifi polymerase, by PCR Biosystems (1 mentions)
6 well polystyrene plates, by Corning (1 mentions)
Polyethylenimine (pei), by Polysciences (1 mentions)
Pgem t vector, by New England Biolabs (1 mentions)
Scai digestion, by New England Biolabs (1 mentions)
Neb turbo competent e coli, by New England Biolabs (1 mentions)
Pgem t vector, by Promega (1 mentions)
11 protocols using pureyield plasmid midiprep kit
1
Plasmid Transformation and Purification
2
CRISPR PAM Discovery in Legionella
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligos (see Supplemental Table S2 ) with a randomized trinucleotide upstream of Sp1 sequence were annealed, digested, and ligated into the ApaI/PstI-cut pMMB207 vector. A total of ∼3000 E. coli colonies were obtained after transformation and combined into a pool. Plasmids were extracted from the E. coli pool using the PureYield Plasmid Midiprep Kit (Promega), and a control plasmid with a scrambled insert was spiked into the plasmid pool at ∼1% ratio. Roughly 1 µg of the pooled plasmids was electroporated into 4 OD units of L. pneumophila str. Toronto-2005 wildtype or Δcas3 overnight culture. Three biological replicates of electroporation were performed. With 5 µg/mL chloramphenicol selection, over 3000 colonies were obtained from each electroporation. Plasmids were then extracted from these L. pneumophila transformants using the EZ-10 Spin Column Miniprep Kit (Biobasic). Without any PCR amplification, these plasmid pools were subjected to the Nextera XT library preparation and Illumina NextSeq sequencing. After quality filtering, reads containing the Sp1 sequence (or the scrambled sequence) were extracted and PAM sequences were identified from these reads. PAM frequencies in L. pneumophila transformants were normalized to both the scrambled control and the E. coli plasmid pool.
3
Plasmid DNA Purification and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For acquisition of high amounts of plasmid DNA, the PureYield™ Plasmid Midiprep kit (Promega, Wisconsin, USA) was used according to the manufacturer’s protocol. The purified plasmid DNA was sterilised and concentrated based on the standard ethanol precipitation protocols90 . Prior to transfection, 50 µg of the concentrated DNA was mixed with appropriate volumes of sterile 1 M Ca(NO3)2 and dH2O to attain a final concentration of 0.1 M Ca(NO3)2 in a final volume of 100 µl.
4
Introducing R658C Mutation in PPP1R15B Plasmid
5
Generation of PPP1R15B R658C Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The R658C mutation was introduced in the PPP1R15BpEGFP_C1 plasmid (21 (link)) using QuikChange II Site-Directed Mutagenesis Kit (Agilent) and the primers huPPP1R15B_R658C_1S: GTGGTGATGAGGATT GCAAAGGACCATGG and huPPP1R15B_R658C_2AS: CCATGGTCCTTTGCA ATCCTCATCACCAC (bold letters indicate the mutation site). This vector allows the expression of recombinant proteins fused to GFP at its N-terminus. After mutagenesis, positive clones were sequenced (Seqlab, Göttingen, Germany), and the following primers were used to cover the entire gene: F1: CATGGTCCTGCTGGAGTTCGTG, F2: AGAGGAGGGGATCCACTG, F3: ACAGTGATGGAAATAGCGAG, F4: ATCTAGTGAGATACCTATGG, F5: TGAGACCCCTGAGCATAG, Rev: CACACCTCCCCCTGAAC. Plasmids containing the mutation but no other change in the PPP1R15B gene were introduced into one-shot TOP10 Electrocomp Escherichia coli (Invitrogen, Gent, Belgium) by electroporation. The cells were recovered for 1 h in SOC medium, plated on Luria broth agar containing 50 µg/mL kanamycin, and incubated overnight at 37°C. Selected colonies were grown overnight at 37°C on Luria broth containing 50 µg/mL kanamycin. Plasmids were purified using the PureYield Plasmid Midiprep Kit (Promega, Leiden, the Netherlands) according to the manufacturer’s instructions. The DNA concentration was measured using NanoDrop 3300 (Thermo Scientific, Gent, Belgium).
6
Gibson Assembly of Fluorescent Protein Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All constructs were generated using Gibson assembly132 (link) and integrated into a PpAct5:Linker:eGFP-MAV4 vector backbone73 (link). Integration of the different coding sequences was done in frame in front of the Linker:eGFP. All parts for the Gibson assembly (inserts and corresponding vector backbones) were amplified either with PhusionTM polymerase (Thermo Fisher Scientific) or with HiFi polymerase (PCR Biosystems Ltd) according to the manufacturer´s instructions. The primers were designed to have a 25 bp overlap to the corresponding fragment to be fused with. All primers and combinations are listed in Supplementary Data S6 . In the case of the N-terminal difference of AtAARE (M1-A55 of AT4G14570.1, gene model provided by TAIR (https://www.arabidopsis.org/ )) the Actin5 promoter was replaced by the CaMV35S promoter133 (link) previously validated in Physcomitrella134 (link).
Cloned plasmids were purified using the PureYield™ Plasmid Midiprep kit (Promega, Wisconsin, USA) according to the manufacturer´s instructions. The plasmids were purified and sterilized via ethanol precipitation129 (link).
Cloned plasmids were purified using the PureYield™ Plasmid Midiprep kit (Promega, Wisconsin, USA) according to the manufacturer´s instructions. The plasmids were purified and sterilized via ethanol precipitation129 (link).
7
Transfection of HEK293 Cells with pEGFP-mTRPM7
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were chemically transfected with pEGFP-mTRPM7 and pEGFP-mTRPM7 S1107R plasmids using polyethyleneimine (PEI) (Polysciences, Warrington, PA) or LT1 (Mirus Bio, Madison, WI) by mixing with DNA and Dulbecco’s phosphate-buffered saline (DPBS) and adding to cells in 6-well polystyrene plates (Corning Incorporated, Kennebunk, ME) (Zhelay et al., 2018 (link)). Plasmid DNA was purified using PureYield plasmid midiprep kit (Promega, Madison, WI).
8
Dual-Insert Plasmid for Fluorescent Dye Calibration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to verify whether the two fluorescent dyes present different intensities of fluorescence emission and to normalize for differences between runs (master mix performance, instrument calibration, environmental variability, etc.) a plasmid construct was designed. A portion of mt-tRNALeu and B2M genes were amplified using the previously reported primers. Two sequential TA cloning reactions were performed to insert the two targets into the pGEM-T vector (Promega Co., Madison, WI, USA). The successful cloning of the two target sequences in a 1:1 ratio was verified by sequencing and PCR. The distance between both inserts was chosen to be greater than 500 bp to avoid the amplification of both targets as one amplicon in the qPCR reaction (Fig. 1 ).![]()
Scheme of the linearized dual insert plasmid (pGEM-T vector, 3194 bp) showing the inserts of human mtDNA and nuclear DNA.
9
CFPS Protocol for GFP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The vendor and catalog number for each organic solvent used in this study is provided in Supplementary Table S1 describing solvent properties. Unless otherwise noted, all other reagents were purchased from Millipore Sigma, St. Louis, MO. Commercial PURExpress kits were purchased from New England Biolabs, Ipswich MA. The plasmid template for expression of GFP via CFPS is PY71sfGFP with genbank accession number MT346027 (38) . Plasmid DNA was purified from transformed E. coli using a Promega PureYield plasmid midiprep kit, followed by ethanol precipitation to further concentrate and purify the DNA. DNA is stored in RNase and DNase-free water at -20°C until reaction assembly.
10
Plasmid Transformation and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pEGFP-N1 plasmid (Clontech) was transformed into XL1-Blue [dut+, ung+] (Stratagene) or CJ236 [dut−, ung−] (NEB, Ipswich, MA, USA) E. coli strains. Cell cultures were grown for 16 h in Luria broth (LB) media supplemented with kanamycin at 37°C, and the plasmids were purified using PureYield™ Plasmid Midiprep Kit (Promega) according to the instructions of the manufacturer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!