The feces swabs were collected from each bird, stored at 4 °C, and transferred to the laboratory within 24 h, with cold chain constantly maintained. Approximately 5 mL of Brain Heart Infusion (BHI) (Oxoid Ltd., Basingstoke, UK) was added to each sample, followed by incubation at 37 °C for 2 h. Subsequently, 1 mL of enriched suspension was streaked onto tryptone bile X-glucuronide agar (TBX agar; Oxoid Ltd., Basingstoke, UK) plates supplemented with 2 mg/L of cefotaxime (Sigma-Aldrich, Munich, Germany) and incubated overnight at 37 °C [26 (link),27 (link)] for recovery of cefotaxime-resistant Enterobacteriaceae (potential producers of ESBL and acquired pAmpC). One colony per sample (bird) was randomly selected, identified using API 20E (Bio-Mérieux. La Balme, les Grottes, France), and confirmed as E. coli via species-specific PCR amplification of the uid gene, encoding for β-glucuronidase (primers used: uid-F: 5′ ATCACCGTGGTGACGCATGTCGC 3′; uid-R: 50 CACCACGATGCCATGTTCATCTGC 3′) [28 (link)].
Tryptone bile x glucuronide agar tbx agar
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
Tryptone bile X-glucuronide agar (TBX agar) is a selective and differential culture medium used for the isolation and enumeration of Escherichia coli in food and water samples. The medium contains tryptone as a source of nutrients, bile salts to inhibit the growth of Gram-positive bacteria, and X-glucuronide, a chromogenic substrate that allows the detection of E. coli through the production of a blue-green color.
Automatically generated - may contain errors
2 protocols using tryptone bile x glucuronide agar tbx agar
1
Cefotaxime-resistant Enterobacteriaceae detection
2
ESBL-Producing E. coli Isolation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An ESBL (TEM-52)-producing strain of E. coli 10,714 assigned to phylogroup B1, isolated from a chicken meat sample, was used in this study. The strain was stored at −20°C in Luria-Bertani Miller broth (Merck Millipore, Darmstadt, Germany) containing 25% (vol/vol) glycerol and cultured at 37°C on tryptone soya agar (Oxoid, Wesel, Germany) for 24 h. Colony material was packaged in Luria-Bertani to a concentration of 7–8 log cfu mL−1. The concentration was verified by inoculating 50 μL of appropriate dilutions in maximum recovery diluent (MRD ) (Merck) by the drop-plating method on Tryptone Bile X-glucuronide agar (TBX-Agar) (Oxoid). Incubation conditions were 37°C for 24 h. The suspension was stored at 4°C for 24 h until use in the experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!