Chamq sybr qpcr master mix

The VEGF and b-FGF expression levels in the BMSCs were measured by performing RT-PCR. The BMSCs were seeded (1 × 10⁴/mL) and incubated on the PCL/R, PCL/M, PCL/MAT, and MP surfaces for 3 days. The cells were washed twice with PBS, and total RNA was harvested from the cells using TRIzol reagent. The RNA concentrations were determined by spectrophotometry. Reverse transcription was performed using a HiScript III RT SuperMix reverse transcription kit for quantitative polymerase chain reaction (qPCR) following the manufacturer’s protocol. After reverse transcription, real-time PCR was performed using a 7500 Real-Time PCR system.
(Applied Biosystems, USA) with ChamQ SYBR qPCR Master Mix. The expression of each gene was normalized to that of GAPDH. The following primer sequences were used for amplification: GAPDH (Forward, TGAAGGTCGGAGTCAACGGATTTG; Reverse, CATGTGGGCCATGAGGTCCACCAC); VEGF (Forward, TTCATGGATGTCTATCAGCG; Reverse, GCTCATCTCTCCTATGTGCT); b-FGF (Forward, GTCAAACTACAGCTCCAAGCAGAA; Reverse, AGGTACCGGTTCGCACACA).

Mouse cochleae and HEI-OC1 cells were homogenized using the TRIzol Kit (Invitrogen) and total RNA was extracted according to the manufacturer’s instructions, of which 1 μg was used for cDNA synthesis via HiScript II One Step RT-PCR Kit (Vazyme). qRT-PCR was performed on a StepOne Plus system (Applied Biosystems) using ChamQ SYBR qPCR Master Mix. The relative expression levels of the selected genes were analyzed using the comparative CT method (2^−ΔΔCT). Each qRT-PCR analysis was repeated at least 3 times and Gapdh was used as an internal control. Conventional qRT-PCR was carried out with the oligonucleotide primers shown in Supplemental Table 1.

For loss-of-function experiments, qPCR was applied to verify the knockdown effectiveness of OX1Rs. Total RNA was extracted utilizing the Eastep^®Super Total RNA Extraction Kit (Shanghai Promega, Cat.# LS1040). The HiScript^® III RT SuperMix for qPCR (+gDNA wiper) (vazyme #R323) was used for cDNA synthesis. The mRNA expression level was analyzed by real-time quantitative PCR instrument (Quant Studio 6 Flex, applied biosystems, USA) with ChamQ SYBR qPCR master mix (without ROX) (vazyme #R321). The primers’ sequences were shown as follows: forward, CTGTGGCGCGATTATCTCTAC, and reverse, GCCAGGGACAGGTTGACAA for OX1R (hypocretin/orexin receptor 1; amplicon: 284 bp, Gene ID: 230777); forward, AAATGGTGAAGGTCGGTGTGAACG, and reverse, AGTGATGGCATGGACTGTGGTCAT for GAPDH (Glyceraldehyde 3-phosphate dehydrogenase; amplicon: 255 bp, Gene ID: 14433).

Total RNA was extracted and purified with FastPure Plant Total RNA Isolation Kit and reverse transcription was employed using HiScript II Q Select RT SuperMix for qPCR. RT-qPCR was performed on Applied Biosystems 7500 and 7500 Fast Real-Time PCR Systems using ChamQ SYBR qPCR Master Mix. PCR cycling conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, 63 °C for 10 s and 72 °C for 30 s. The cDNA melting curve was set as usual. Relative gene expression was calculated using 2^−ΔΔCT method, calibrated against GAPDH or beta Actin.

Total RNA from CRC tissues, CRC cells, or M2 macrophages were extracted using the RNAiso Plus reagent (TaKaRa, Osaka, Japan) followed by reverse transcription to cDNA, and then qPCR was performed based on SYBR green (SYBR green qPCR Master Mix; Vazyme, Nanjing, China). The reaction system includes 10 μL 2 × ChamQ SYBR qPCR Master Mix, 0.4 μL 50 × ROX Reference Dye2, 0.5 μL primer mix, 1 μL template cDNA, and make up with nuclease-free water to a final volume of 20 μL. The amplification conditions were 95 °C for 35 s, 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. All reactions were run in triplicate using an ABI 7500 PCR System (Applied Biosystems, Waltham, MA, USA). mRNA expression levels of target gene expression were normalized to GAPDH levels using the formula 2^−ΔΔCT. These sequences of used primers are shown in Table S1.

Total RNA was extracted and purified with FastPure Plant Total RNA Isolation Kit and reverse transcription was employed using HiScript II Q Select RT SuperMix for qPCR. RT-qPCR was performed on Applied Biosystems 7500 and 7500 Fast Real-Time PCR Systems using ChamQ SYBR qPCR Master Mix. PCR cycling conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, 63 °C for 10 s and 72 °C for 30 s. The cDNA melting curve was set as usual. Relative gene expression was calculated using 2^−ΔΔCT method, calibrated against GAPDH or beta Actin.