The largest database of trusted experimental protocols

Aminolink plus coupling resin

Manufactured by Thermo Fisher Scientific
Sourced in United States

The AminoLink Plus Coupling Resin is a pre-activated agarose resin designed for the covalent immobilization of ligands containing primary amino groups. It can be used for the purification and isolation of target proteins, antibodies, and other biomolecules.

Automatically generated - may contain errors

30 protocols using aminolink plus coupling resin

1

Purification of Peptide-HLA Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Peptide-HLA-A*02:01 complexes were purified according to a previous report39 (link) with minor modifications. A total of 3.6 L of collected culture supernatant (1.2 × 109 cells) was pre-cleared with inactivated AminoLink Plus Coupling Resin (Thermo Fisher Scientific) to remove nonspecific proteins, followed by immunoprecipitation with anti-CII mouse monoclonal antibody (6G4)-immobilised AminoLink Plus Coupling Resin (Thermo Fisher Scientific). After a series of wash steps, the interacted epitope peptides were dissociated from HLA molecules using 10% acetic acid at 90 °C for 5 min and then passed through a 10 kDa molecular mass cutoff filter (Millipore Corp, Bedford, MA). The isolated peptides were fractionated using a MonoSpin SCX spin column (GL Sciences Inc., Tokyo, Japan) according the manufacturer’s instructions. The eluate from 350 mM NaCl was desalted using a MonoSpin C18 spin column (GL Sciences Inc.) according to the manufacturer’s instructions and dried using a savant SPD2010 SpeedVac system (Thermo Fisher Scientific).
+ Open protocol
+ Expand
2

Purification of Autoantibodies from SLE Patients

Check if the same lab product or an alternative is used in the 5 most similar protocols
The purification of the specific antibody was performed using AminoLink Plus Coupling Resin according to the manufacturers' instructions (MicroLink, Thermo Scientific, USA). We purchased recombinant human Tyro3 protein (Abnova, Taiwan) and coupled the protein to the resin. Then, we used the purified total IgG from SLE patients to form the resin-bound complex and incubated them with gentle end-over-end mixing. The eluted antibody was neutralized with 1 M Tris (pH = 9.0). After sterile filtration, the autoantibody was stored as small aliquots at -80°C.
+ Open protocol
+ Expand
3

Cloning and Purification of AtrR Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
A region of 597 bp (corresponding to the 199 N-terminal amino acids) from atrR were PCR amplified and cloned in frame as BamHI/SalI fragments downstream of the 6×-His tag in pET28a+ (EMD Millipore, Inc.) to form pGT3 and transformed into the bacterial strain Escherichia coli BL21(DE3). Two liters of transformed bacteria was grown to log phase and induced with isopropyl-β-d-thiogalactopyranoside (IPTG) for 90 min. Cell lysates were prepared using a French press. Protein purification was accomplished using Talon metal affinity resin (TaKaRa Bio USA, Inc.) as described by the manufacturer. Protein fractions were analyzed by staining them with Coomassie blue and by Western blotting using His-specific antibodies. The purified proteins were then lyophilized and sent to Pacific Immunology (Ramona, CA) for injection into rabbits to generate polyclonal antibodies against AtrR. Antiserum generated from these rabbits was received and tested for immunoreactivity against A. fumigatus cell lysates. The antiserum was then purified using an AminoLink Plus coupling resin (Thermo Scientific, Inc.) according to the manufacturer’s instructions, and the affinity-purified antiserum was used to detect the AtrR protein from A. fumigatus cell lysates.
+ Open protocol
+ Expand
4

Recombinant Expression and Purification of FETUA-3

Check if the same lab product or an alternative is used in the 5 most similar protocols
A DNA fragment encoding amino acids 78 to 268 of FETUA-3 was PCR amplified and cloned into the GST-tag expression vector pGEX-6P1. To express GST-cASF-B1, Rosetta-gami™ 2(DE3)pLacI (Agilent Technologies) cells were transformed with the recombinant construct. GST-FETUA-3 expression was achieved by induction with 1 mM IPTG. Since most of the protein was insoluble, we resorted to isolation of inclusion bodies (50 ). The recombinant protein containing inclusion body suspension was used to immunize two New Zealand white rabbits (UPFRL). Sera were tested for immunoreactivity on Western Blots, and antibodies were affinity purified on His-FLAG-FETUA-3 cross-linked to Aminolink Plus Coupling Resin (Thermo Scientific catalog # 20501).
+ Open protocol
+ Expand
5

Antibody Generation and Verification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were purchased: anti-Flag (MBL, M185-3L), anti-HA (MBL, M180-3), anti-VAPB (Proteintech, 14477-1-AP and 66191-1-Ig), anti-SCRN1 (Proteintech, 14303-1-AP), anti-GAPDH (Proteintech, 60004-1-Ig and 10494-1-AP), anti-poly/mono-ADP-ribose (Cell Signaling Technology, 83732S), PAR/pADPr (R&D Systems, 4335-MC-100), anti-Calnexin (Novus, NB300-518), anti-His (Proteintech, 66005-1-Ig), anti-GST (Proteintech, 66001-2-Ig), DyLight 488-conjugated goat anti-mouse IgG (Abbkine, A23210), Dylight 594-conjugated goat anti-rabbit IgG (Abbkine, A23420), horseradish peroxidase (HRP)-conjugated mouse anti-rabbit IgG LCS (Abbkine, A25022), HRP-conjugated goat anti-mouse IgG (Proteintech, 15014), and HRP-conjugated goat anti-rabbit IgG (Proteintech, 15015).
Antibodies against ARTC1, ARTC3, ARTC4, and ARTC5 were generated by immunizing rabbits with recombinant proteins GST-ARTC1 (N23–C295), GST-ARTC3 (N27–C362), GST-ARTC4 (N47–C285), and GST-ARTC5 (N23–C291), respectively, purified in our laboratory. Serum samples were obtained from immunized rabbits and incubated with AminoLink Plus Coupling Resin (Thermo, 20501) in Pierce Disposable Plastic Columns (Thermo, 29922). The resin was washed three times with PBS. Antibodies were eluted by 100 mM Glycine (pH 2.5).
+ Open protocol
+ Expand
6

Quantification of Collagen XIX NC1 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
NC1 integrin binding was assessed by conjugating NC1 peptides with AminoLink Plus coupling resin (ThermoFisher Scientific). 0.4 mg collagen XIX NC1-, NC3-, or NC1-Scrambled peptide was dissolved in coupling buffer (0.1 M sodium phosphate and 0.15 M NaCl, pH 7.2) and conjugated with AminoLink Plus resin. Cyanoborohydride solution (5 M NaCNBH3 in 1 M NaOH) was added and incubated overnight at 4°C. After serial washing with coupling buffer, quenching buffer (1 M Tris-HCl, pH 7.4), wash solution (1 M NaCl), and binding buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 2 mM EDTA, pH 8.0, 1% Triton X-100, and 50 mM NaF), cortical protein extracts (from P15 WT brains lysed in binding buffer) were incubated in the column overnight at 4°C. After washing with binding buffer, bound proteins were eluted in 1% SDS buffer. Eluted samples were precipitated with 15% trichloroacetic acid on ice, pelleted by centrifugation, and resuspended in lysate buffer (80 mM Tris-HCl, pH 6.8, 2% SDS, and 10% glycerol). Eluted protein was analyzed by Western blot.
+ Open protocol
+ Expand
7

Rabbit Polyclonal Antibody Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit polyclonal antibody (PAb) generation was outsourced and produced against the purified recombinant protein (Washington Biotechnology, Baltimore, MD). AgSGU-specific antibody was purified from serum by affinity chromatography using AminoLink Plus Coupling Resin (Thermo Fisher, Rockford, IL) to which recombinant AgSGU was immobilized. To generate Fab fragments AgSGU-specific antibody, normal rabbit IgG (Life Technologies), and normal rabbit IgM (Southern Biotech, Birmingham, AL) was digested with papain (Thermo Fisher) overnight at 37°C.
+ Open protocol
+ Expand
8

Polyclonal Antibody Generation and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polyclonal antibodies were generated in rabbit against His-EmVcl, His-EmFAK and GST-EmITGB1 (Syd Labs) recombinant proteins. For affinity purification, two columns were made: (1) whole E. coli lysates, and (2) 6–10 mg of recombinant protein. Each was covalently bound to 1 mL of AminoLink Plus Coupling resin (Thermo Scientific, Cat#20501) according to the manufacturer specifications. Anti-sera were passed over the E. coli column to remove antibodies against bacterial proteins; then the flow-through was incubated with the antigen-coupled resin for 1 h at RT under rotation. This column was washed with 12 mL of AminoLink Wash Buffer and the antibodies were eluted with 500 µL 0.1 M glycine HCl, pH 2.5. The pH of eluted fractions was adjusted to neutral by adding 30 µL of 0.75 M Tris–HCL pH 9.0. Antibody titer was quantified by spectrophotometry (A280) and by visual comparison to BSA standards via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS/PAGE). The specificity of each antibody was validated by Western Blot, Immunoprecipitation coupled with LC–MS/MS, and by pre-adsorption with the injected antigen prior to immunostaining.
+ Open protocol
+ Expand
9

Purification and Coupling of Monoclonal Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human mantle cell lymphoma cell line MAVER-1 was a kind gift of Prof Alberto Zamo [20 (link)]. The human follicular lymphoma cell line DOHH-2 was obtained from the DSMZ, (Braunschweig). Cell lines were cultivated in RPMI 1640 medium (Gibco) with 10% heat-inactivated FCS (Gibco). HLA typing was performed by the MVZ (Martinsried, Germany) [Supporting Information Table 1]. The L243 hybridoma cell line (HB-55) and the W6/32 hybridoma cell line (HB-95) were obtained from ATCC, the SPVL3 hybridoma cell line was a kind gift of Prof Dr Hergen Spits. Hybridoma cells were cultivated in CD Hybridoma medium (Gibco) with 2 mM glutamine (Ultraglutamine I, Lonza), at 37°C and 5% CO2. The L243 [21 (link)–23 (link)], SPVL3 [24 (link)–29 (link)] and W6/32 antibodies were purified from the respective hybridoma supernatants using Protein-A Sepharose and subsequently coupled to AminoLink Plus Coupling Resin (Thermo Fisher Scientific) following the manufacturer`s instructions.
+ Open protocol
+ Expand
10

Recombinant SlHY5 Protein Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length SlHY5 open reading frame was amplified from tomato cDNA using the primers HY5-F (CTTTAAGAAGGAGATATACATATGCACCATCATCATCATCATCAAGAGCAAGCGACGAGTTC) and HY5-R (GTGGTGGTGGTGGTGGTGCTCGAGCTACTTCCTCCCTTCCTGTG). The PCR product was inserted into the pET30a vector digested with Nde I and Xho I using a ClonExpress Ultra One Step Cloning Kit (Vazyme, C115) to generate pET30a-6×His-SlHY5. The recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent cells, and the expression of the recombinant protein was then induced with 1 mM isopropyl-1-thio-β-d-galactopyranoside. The recombinant protein was purified using Ni-NTA His Bind Resin (Merck, 70666) following the manufacturer’s instructions, and rabbits were immunized with the purified recombinant protein at Beijing Protein Innovation Company (http://www.proteomics.org.cn/). Polyclonal antibody was affinity purified from antisera using AminoLink Plus Coupling Resin according to the manual (Thermo Scientific, 20501).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!