β actin

Manufactured by Sangon

Sourced in China, United States

β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is a component of the microfilament system and plays a crucial role in various cellular processes, such as cell motility, cell division, and maintenance of cell shape and structure.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Anti-β-actin (18 citations) Rabbit anti-β-actin (4 citations) β-actin antibody (4 citations) β-actin primers (3 citations) Anti-β-Actin antibody (3 citations) Mouse β-actin (2 citations) Anti-β-actin (D110007) (2 citations) Mouse monoclonal anti-β-actin (2 citations) Chicken β-actin (2 citations)

101 protocols using β actin

Quantifying NLRP3 Expression in HaCaT Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HaCaT cells were cultured as per the aforementioned procedures. RNAiso Plus reagent (TaKaRa, Japan, cat. no. 108–95-2) was utilized to extract total RNA from the cells according to the manufacturer’s guidelines. RevertAid First-strand cDNA Synthesis kit (ThermoFisher Scientific, UAB, K1622) was used to synthesize cDNA. For quantifying NLRP3 expression, q-PCR was conducted on a CFX96 Touch thermocycler (Applied Biosystems) utilizing SYBR^® Premix Ex Taq™ II (Applied Biosystems/ThermoFisher Scientific, UAB, A25742). The following primer sequences were used for NLRP3 and β-actin (Sangon Biotech, Shanghai, China):
NLRP3 (forward primer): 5’-CCAGAGCCTCACTGAACTGG-3’,
NLRP3 (reverse primer): 5’-AGCATTGATGGGTCAGTCCG-3’;
β-actin (forward primer): 5’-CTGTGTGGATTGGTGGCTCT-3’,
β-actin (reverse primer): 5’-GCTCAGTAACAGTCCGCCTA-3’.
PCR amplification involved heating the samples at 95 °C for 30 sec, followed by 45 cycles of 95 °C for 5 sec and 55 °C for 30 sec. β-actin was utilized as an endogenous control to normalize differences. A PCR post-data analysis software program was utilized to process fluorescence data. The 2^−ΔΔCT method was utilized to analyze differences in gene expression.

Luan C., Lu Z., Chen J., Chen M., Zhao R, & Li X. (2023). Thalidomide Alleviates Apoptosis, Oxidative Damage and Inflammation Induced by Pemphigus Vulgaris IgG in HaCat Cells and Neonatal Mice Through MyD88. Drug Design, Development and Therapy, 17, 2821-2839.

+ Open protocol

+ Expand

Quantification of lncRNA, miRNA and mRNA Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Invitrogen). qRT-PCR was conducted using an ABI 7300 Fast real-time PCR system and SYBR Green Master mix to determine the relative expression levels of lncRNA SNHG12, miR-138-5p, and NFIB mRNA. miRNA and mRNA expression levels were normalized to U6 and GAPDH, respectively. The following primers for β-actin, U6, lncRNA SNHG12, miR-138-5p, and NFIB (Sangon Biotech, Shanghai, China) were used:
β-actin-forward, 5ʹ-CGTGGAACTGGCAGAAGAGG-3ʹ;
β-actin-reverse, 5ʹ-GGAATGAGAAGAGGCTGAGACA-3ʹ;
U6-forward, 5ʹ-GCTTCGGCAGCACATATACTAAAAT-3ʹ;
U6-reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3ʹ;
lncRNA SNHG12-forward, 5′-GAAAAAGCACACCAGCTATTGG-3ʹ;
lncRNA SNHG12-reverse, 5′-CGGGATCTCTGTAGACTAAGTCAGT-3ʹ;
miR-138-5p-forward, 5′-GCGAGCTGGTGTTGTGAATC-3ʹ;
miR-138-5p-reverse, 5′-AGTGCAGGGTCCGAGGTATT-3ʹ;
NFIB-forward, 5′-TGAGGCAGCTTCACCTACAG-3ʹ;
NFIB-reverse, 5′-AGGATGGGTCTCTTGGGCTTA-3ʹ. Target gene expression was quantified using the 2^−ΔΔCt method [22 (link)].

Yan L., Li L, & Lei J. (2021). Long noncoding RNA small nucleolar RNA host gene 12/microRNA-138-5p/nuclear factor I/B regulates neuronal apoptosis, inflammatory response, and oxidative stress in Parkinson’s disease. Bioengineered, 12(2), 12867-12879.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction, RT and quantitative PCR were performed as described previously [53 (link)]. Primer pairs (5´-3´) were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) as follows: Pim-1 (NM_017034.1) forward, ctgctcaaggacacagtctaca; Pim-1 reverse, agggacaggcaccatctaataa; PCNA (NM_022381.1) forward, gggtgaagttttctgcgagt; PCNA reverse, cagtggagtggcttttgtga; β-actin (NM_031144) forward, cccatctatgagggttacgc, β-actin reverse, tttaatgtcacgcacgatttc. PCR was conducted using a LightCycler480 II instrument (Roche Ltd., Guangzhou, China). Relative abundances of target mRNAs were determined from the C_T values and plotted as the fold-change compared with the control groups.

Wang K., Deng X., Shen Z., Jia Y., Ding R., Li R., Liao X., Wang S., Ha Y., Kong Y., Wu Y., Guo J, & Jie W. (2017). High glucose promotes vascular smooth muscle cell proliferation by upregulating proto-oncogene serine/threonine-protein kinase Pim-1 expression. Oncotarget, 8(51), 88320-88331.

+ Open protocol

+ Expand

Vitexin Attenuates LPS-Induced Inflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vitexin, with a purity >99.9%, was obtained from Xi'an Haoxuan Biotechnology Co. Ltd., (Xi'an, China). The P38 MAPK inhibitor, SB203580, was purchased from Selleck Chemicals (Houston, TX, USA). RPMI-1640 medium and fetal bovine serum (FBS) were purchased from Gibco; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). LPS was purchased from Sigma-Aldrich; Merck Millipore Darmstadt, (Germany). Rabbit polyclonal antibodies against HMGB1 (Rabbit IgG, cat. no. 6893, 1:1,000), Bcl2 (Rabbit IgG, cat. no. 2876, 1:1,000), cleaved caspase-3 (Rabbit IgG, cat. no. 9664, 1:1,000), P38 (Rabbit IgG, cat. no. 14451, 1:1000), phosphorylated (p-)P38 (Rabbit IgG, cat. no. 4092, 1:1,000) and β-actin (Rabbit IgG, cat. no. 4970, 1:1,000) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). The streptavidin-peroxidase (SP) and 3,3′-diaminobenzidine kits were purchased from Beijing Zhongshan Golden Bridge Biotechnology; OriGene Technologies, Inc. (Rockville, MD, USA). The primers (P38, F:GCC TCA CCG CCT CAG TAT , R:GCA GTC TTC TCA TTC CCT TG; β-actin, F:TTT TGT GCC TTG ATA GTT CG, R:GGA GTC CTT CTG ACC CAT AC-3) for P38 (Mapk14) and β-actin were synthetized by Sangon Biotech Co., Ltd. (Shanghai, China). HMGB1 and the TNF-α enzyme-linked immunosorbent assay (ELISA) kits were purchased from R&D Systems (Minneapolis, MN, USA).

Wang F., Yin J., Ma Y., Jiang H, & Li Y. (2017). Vitexin alleviates lipopolysaccharide-induced islet cell injury by inhibiting HMGB1 release. Molecular Medicine Reports, 15(3), 1079-1086.

+ Open protocol

+ Expand

Real-time PCR Analysis of 6-methoxyflavone in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time fluorescence quantitative polymerase chain reaction (PCR)
Single-cell suspensions were seeded into 6-well plates for 24 h. HeLa cells were then treated with either 6-methoxyflavone (65 lM) or 0.16% DMSO for 48 h. Total RNA was extracted from 6-methoxyflavone-treated HeLa cells using RNAiso Plus reagent (Takara, Dalian, China). The complementary DNA was synthesized by genomic DNA eraser reaction and reverse transcription reaction using the PrimeScript TM RT reagent kit (Takara). Real-time PCR was performed using the TB Green V R Premix Ex Taq TM II kit (Takara). Glyceraldehyde 3phosphate dehydrogenase (GAPDH) and b-actin (Sangon Biotech, Shanghai, China) were used as housekeeping genes.
The Livak method was used to analyze the relative quantitative real-time PCR data. The real-time PCR primer sequences are listed in Table 2.

Zhang C., Quan Y., Bai Y., Yang L, & Yang Y. (2022). The effect and apoptosis mechanism of 6-methoxyflavone in HeLa cells. Biomarkers : biochemical indicators of exposure, response, and susceptibility to chemicals, 27(5).

+ Open protocol

+ Expand

Immunofluorescence and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunofluorescence, 8-mm paraffin sections were used, and the staining was documented using a Leica DM6000 B microsystems station (Leica, Wetzlar, Germany). Standard protocols were followed for histology, Western blot, and immunoprecipitation. For Western blot analysis, each experiment was repeated at least three times, and representative results are shown. Quantification of the staining results and Western blot was performed using the ImageJ program (National Institutes of Health, Bethesda, MD). The percentage of g-H2AXe and YAP1-positive nuclei and total epidermal keratinocytes were counted in the epidermis in at least five different regions per biopsy sample and from at least five independent experiments. Antibodies and reagents used were FITC-phalloidin, b-catenin (Sigma, Shanghai, China), E-cadherin, pY99 (Santa Cruz, Dallas, TX), Src (Boster, Wuhan, China), YAP1 (ProteinTech, Wuhan, China), p-Src, Myc, b-actin (Sangon, Shanghai, China), and active caspase-3 (R&D systems, Lulong, Xiamen, China). Argarose AþG beads were purchased from Beyotimes (Shanghai, China). TUNEL (Roche, Shanghai, China) and propidium iodide staining 1 mg/ml in phosphate buffered saline) was performed as described previously (Xie et al., 2015) .

Xie G., Ao X., Lin T., Zhou G., Wang M., Wang H., Chen Y., Li X., Xu B., He W., Han H., Ramot Y., Paus R, & Yue Z. (2017). E-Cadherin-Mediated Cell Contact Controls the Epidermal Damage Response in Radiation Dermatitis. The Journal of investigative dermatology, 137(8).

+ Open protocol

+ Expand

Evaluating NSUN5 Expression in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

NSUN5 transcript levels were evaluated using RT-qPCR. Total RNA was extracted from BMSCs using TRIzol (Invitrogen). RNA purity and concentration were determined by measuring the absorbance at 280 and 260 nm using a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The RNA was converted into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Primers for amplifying NSUN5, Trap1, Fth1, Ftl, and beta-actin were obtained from Sangon Biotech (Shanghai, China). The sequences of the primers used are shown in Supplementary Table 1. qPCR was performed in a LightCycler 480 II instrument (Roche Applied Science, Basel, Switzerland) using a SYBR Green Master Mix.

Liu J., Ren Z., Yang L., Zhu L., li Y., Bie C., Liu H., Ji Y., Chen D., Zhu M, & Kuang W. (2022). The NSUN5-FTH1/FTL pathway mediates ferroptosis in bone marrow-derived mesenchymal stem cells. Cell Death Discovery, 8, 99.

+ Open protocol

+ Expand

Western Blot Analysis of ECM Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intracellular proteins were Extracted employing RIPA buffer and PMSF (Beyotime, Shanghai, China) at 99:1 ratio. And total protein was quantified with a BCA kits (Thermos Fisher Scientific, USA). Then, equal amounts of protein were separated by SDS-PAGE (10% gels), and transferred to PVDF membranes (Sigma-Aldrich, USA). After blocking with 5% skim milk for 1 h, the membranes were incubated with the primary antibodies overnight at 4°C. The next day, the membranes were incubated at room temperature for 1 h with specific secondary antibodies. The membranes were rinsed following by chemiluminescence imaging. Quantitative analysis of Western blots was conducted by ImageJ software. Antibodies: FN (Abcam, #ab45688, 1:1000), COL1A1 (CST, #72026, 1:1000), MMP9 (Abcam, #EP1254, 1:1000), CHI3L1 (Abcam, # ab255297, 1:1000), beta-actin (Sangon, #D110001, 1:2500). Image J was used to quantify the gray values for each target proteins bands.

Cai J., Lyu X., Huang P., Li S., Chen R., Chen Z., Sun M., Zeng L., Wu F, & Hu M. (2022). Increased Levels of CHI3L1 and HA Are Associated With Higher Occurrence of Liver Damage in Patients With Obstructive Sleep Apnea. Frontiers in Medicine, 9, 854570.

+ Open protocol

+ Expand

Quantifying NFAT5 and SGK-1 in ARPE-19 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Confluent ARPE-19 cells were cultured with serum-free DMEM for 24 h, and then the cells were stimulated with or without NaCl in the presence of LPS for 3 h. RNA was isolated using TRIzol reagent and reverse transcribed to cDNA using Strand cDNA Synthesis Kit (TAKARA, Dalian, China). The primers (NFAT5: forward, 5′-GCAATGGTGATGGAGATGC-3′; reverse, 5′-CTGCTGGTAAACTGGCGATT-3′; SGK-1: forward, 5′-AACACAACAGCACAACATCCA-3′; reverse, 5′-CACCACCAGTCCACAGTCCT-3′; beta-actin: forward, 5′-GGATGCAGAAGGAGATCACTG-3′; reverse, 5′-CGATCCACACGGAGTACTT-3′) were purchased from Sangon Biotech (Shanghai, China). mRNA expression was determined by real-time PCR using the SYBR Green master mix under standard thermocycler condition. Data were collected and quantitatively analyzed on a sequence detection system (ABI Prism 7500, Applied Biosystems). Gene expression was normalized relative to the expression of β-actin using methods described elsewhere [22 (link)].

Zhang D., Wang C., Cao S., Ye Z., Deng B., Kijlstra A, & Yang P. (2015). High-Salt Enhances the Inflammatory Response by Retina Pigment Epithelium Cells following Lipopolysaccharide Stimulation. Mediators of Inflammation, 2015, 197521.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cultured cells or frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, California, USA), and RNA was reverse-transcribed by an RT-PCR kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer’s instructions. Quantitative PCR was then carried out with primers for miR-219, SMC4, JAK2, and Stat3 with SYBR Green PCR Master Mix (Invitrogen, Carlsbad, California, USA) in a real-time PCR System (Applied Biosystems, Carlsbad, California, USA) following standard quantitative PCR procedure [18 (link)]. Primers are shown in Table 1. SMC4, JAK2, and Stat3 levels were analyzed. The programs were as follows: PCR mixtures were denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 20 s, 61°C for 20 s, and 72°C for 20 s, and a final extension at 72°C for 5 min, 55°C for 10 s. miR-219 was analyzed as follows: PCR mixtures were incubated at 95°C for 5 min, followed by 40 cycles with incubation at 95°C for 10 s, 60°C for 20 s, 72°C for 10 s. Data were normalized to the geometric mean of the housekeeping gene, β-actin and U6 (Sangon Biotech, Shanghai, China) as the control.

Zhou B., Chen H., Wei D., Kuang Y., Zhao X., Li G., Xie J, & Chen P. (2014). A novel miR-219-SMC4-JAK2/Stat3 regulatory pathway in human hepatocellular carcinoma. Journal of Experimental & Clinical Cancer Research : CR, 33(1), 55.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!