Full-length human DEK cDNA was generated from human CD34positive cells and cloned into the EcoRI site of MSCV-IRES-GFP (MIG) retroviral vector. DEK primers used for cDNA preparation were as follows: forward 5’-ATGTCCGCCTCGGCC-3’, reverse 5’-TCAAGAAATTAGCTCTTTTACAG-3’. The integrity of the cDNA was confirmed by sequencing. VSVg peudotyped retrovirus was prepared using MIG and MIG-DEK constructs as described [19 (link)]. A scrambled non-targeting (Origene, Rockville, MD, TR30021) and DEK-specific short hairpin (sh)-lenti viral constructs (Origene, TL313507) were used to prepare VSVg pseudotyped third generation lentivirus [19 (link)]. Transduced cells were propagated and GFPpositive cells were sorted using FACS. Constructs that gave the greatest knockdown of DEK (Origene, TL313507B (shDEK-B), TL313507C (shDEK-C)) were used in further experiments.
Tr30021
Manufactured by OriGene
Sourced in United States
TR30021 is a laboratory equipment product. It is a high-quality instrument designed for specific laboratory applications. The core function of this product is to perform essential tasks in a research or testing environment.
Automatically generated - may contain errors
Lab products found in correlation
Pspax2, by Addgene (2 mentions)
Tl705799, by OriGene (2 mentions)
Linpei25, by Polysciences (2 mentions)
Jetprime transfection reagent, by Polyplus Transfection (1 mentions)
Pmd2 g plasmid, by Addgene (1 mentions)
Puromycin, by InvivoGen (1 mentions)
Lsrfortessa, by BD (1 mentions)
Sw32ti, by Beckman Coulter (1 mentions)
Pgfp c shlenti vector, by OriGene (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Lenti pac expression packing kit, by GeneCopoeia (1 mentions)
12 protocols using tr30021
1
Generating DEK cDNA Constructs
2
Knockdown of Cdk5 via shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
About 24 hr after seeding cells, different shRNA Cdk5 plasmids (Origene TL515615 A/B/C/D Cdk5 shRNA) were transfected to knock down Cdk5 according to the manufacturer’s instructions. The knock-down efficiency was assessed at 48 hr post transduction by western blotting. Scrambled shRNA plasmid (Origene TR30021) was used as a negative control.
3
Lentiviral Knockdown of TRIT1 in DMS-273 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral plasmids for TRIT1 human shRNA (TL300819-C, Origene, Rockville, MD, USA) and scrambled shRNA (TR30021, Origene, Rockville, MD, USA), both cloned in pGFP-C-shLenti vector, were used. To obtain the lentiviral particles, 10 μg of plasmid were mixed with 7.5 μg of ps-PAX2 and 2.5 μg of PMD2.G plasmid (Addgene, Watertown, MA, USA), using jetPRIME® Transfection Reagent (Polyplus Transfection, New York, NY, USA). The transfection mix was added to HEK293 cells at 80% confluence. After 72 h, medium with high-titer lentiviral particles was 0.45 μm-filtered and DMS-273 cells were cultured in virus containing medium for 24 h. After five passages, green fluorescent cells were sorted by fluorescence-activated single cell sorting (FACS).
4
Nid1 Knockdown in RJ423 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RJ423 cells have been previously described (8 (link)–11 (link)). To reduce Nid1 expression, RJ423 cells were transfected with four unique shRNAs targeting Nid1 (cat. no. TL501474; Origene Technologies Inc.) or a control shRNA (cat. no. TR30021; Origene Technologies Inc.). Stable clones were selected using 5 µg/ml puromycin (InvivoGen). Two knockdown lines (RJ423shNid1A and RJ423shNid1D) were identified as having the greatest Nid1 mRNA knockdown relative to a control line (RJ423con). All cells were cultured as described in (8 (link)). RJ423shNid1A, RJ423shNid1D and RJ423con cells were maintained in 5 µg/ml puromycin.
5
Lentiviral Particles Production for SORLA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral particles containing sequences encoding shRNA against SORLA and GFP or a control scramble shRNA sequence and GFP or particles encoding for SORLA-GFP or GFP alone were generated in the 293FT packaging cell line (complete medium: high glucose DMEM, 10% FBS, 0.1 mM NEAA, 1 mM MEM Sodium Pyruvate, 6 mM l -glutamine, 1% penicillin/streptomycin and 0.5 mg/ml Geneticin) by transient transfection of transfer vector (#TL309181A SORL1 SR031650, #TL309181B SORL1 SR031650, #TL309181C SORL1 SR031650, #TL309181D SORL1 SR031650, or scramble control (#TR30021, Origene), second-generation packaging plasmid-psPAX2 (Addgene #12259) and envelope vector-pMD2 (Addgene #12260) with the ratio (7:2:1) using calcium-phosphate precipitation method50 (link). Seventy-two hours post transfection, medium containing viral vectors was collected, concentrated for 2 h by ultracentrifugation (26,000 × g) in a swing-out rotor SW-32Ti (Beckman Coulter, Brea, CA, USA), resuspended in residual medium and flash frozen in liquid nitrogen. Functional titre was evaluated in 293FT cells by FACS (BD LSRFortessa, Becton Dickinson).
6
Nup358 Knockdown in Mouse Cortical Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Scrambled negative control shRNA (shCTRL, Origene TR30021) and a pool of four mouse gene-specific Nup358 shRNA constructs (shNup358, Origene TL501860) in pGFP-C-shLenti Vector (Origene, Rockville, MD, USA) plasmids were used for the knockdown experiments as previously described [14 (link)]. Briefly, mouse cortical neurons were transfected on DIV 5 with shRNA constructs using Lipofectamine 2000 reagent (Invitrogen, Waltham, MA, USA) following the manufacturer’s instructions and processed on DIV 14.
7
Lentiviral Knockdown of Depdc5 and Tsc2 in Neurons
8
Plasmid-mediated Silencing of Per2 in NIH 3T3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following plasmids were used for the project:
NIH 3T3 cells were co-transfected with either ICAP_NLS/ Scramble shRNA or ICAP_NLPS/shRNA Per2 in 2 cm dishes at about 70% of their total confluency using linear polyethyleneimine (LINPEI25; Polysciences Europe). The amounts of expression vectors were adjusted to yield comparable levels of the expressed protein. Thirty hours after transfection, cells were induced with forskolin, and the appropriate experiment was performed.
ICAP-NLS Vector carrying the two domains KID (CREB) and KIX (CBP) fused with fluorophores as described before, kindly provided by Prof. Dominique Glauser (University of Fribourg, CH)48 (link).
Scramble Sh RNA vector used as a control for the in vitro silencing of Per2 (Origene cat #TR30021).
Sh RNA Per2 Vector used for silencing Per2 in cell lines. (Origene cat #TL501620).
NIH 3T3 cells were co-transfected with either ICAP_NLS/ Scramble shRNA or ICAP_NLPS/shRNA Per2 in 2 cm dishes at about 70% of their total confluency using linear polyethyleneimine (LINPEI25; Polysciences Europe). The amounts of expression vectors were adjusted to yield comparable levels of the expressed protein. Thirty hours after transfection, cells were induced with forskolin, and the appropriate experiment was performed.
9
Lentiviral Knockdown of Depdc5 and Tsc2 in Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral stocks for lentiviral infection were prepared by co-transfection of the two packaging plasmids psPAX2 and pMD2.G into HEK293T cells with the plasmid to be co-expressed using PEI. Viral particles were collected 48hrs and 72hrs after transfection and filtered through a 0.45 mm membrane. Rat neurons were infected at 1 day in vitro (DIV1) for 6 h then replaced by fresh NB/B27 medium. Depdc5 knockdown was achieved by (sh) RNAs (Origene, TL705799) and a non-effective 29-mer scrambled shRNA (Scr) construct (Origene, TR30021) in a pGFP-C-Lenti vector. Sequences used were shDepdc5: TGTCCGA CCTGGAGGATACACGCCTCAGA and shScramble: GCACTACCAGAGCTAACTCAGATAGTACT. The lentiviral Tsc2 shRNA construct was previously described (Di Nardo et al., 2009 (link)). The target sequence for the Tsc2 gene was the following: GGTGAAGAGAGCCGTATCACA. For Tsc2 knockdown, GFP-tagged control shRNA construct (here referred as ctrl-sh) was against the luciferase gene was previously described (Flavell et al., 2006 (link)). For double-knockdown of Depdc5 and Tsc2 (DTKD), lentivirus with shDepdc5 was introduced on DIV1 followed by lentivirus with shTsc2 on DIV5. All experiments were performed between DIV11–12. Only confluent neuronal cultures with at least 80% transduction, as detected by GFP + fluorescence, were used for subsequent experiments.
10
Stable Knockdown Cell Lines via Lentiviral shRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNAs for PGAM5 (TL318057), KEAP1 (TL303778), AIFM1 (TL302572) and shCont (TR30021) constructs in lentiviral GFP vector were procured from OriGene Technologies (Rockville, MD, USA):
PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG
PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC
KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA
KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC
AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA
shCont: GCACTACCAGAGCTAACTCAGATAGTACT
Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions. HT-29 and CaCo-2 cells were transduced by these viruses and puromycin selection (0.3 μg/mL for HT-29 and 0.15 μg/mL for CaCo-2 cells) was carried out in order to make the stable cell lines. Scrambled shRNA sequence was used as a negative control for shRNA-targeted experiments.
PGAM5-shRNA-1: ATCACAGCAATGAACACCATCCGAAGCGG
PGAM5-shRNA-2: CCAAGCAAGAGGAGTTCTTCAACCTGTCC
KEAP1-shRNA-1: GAACCACTGTCTCTGATCAACGTGCGGAA
KEAP1-shRNA-2: CCAACGTCATCCGCTACATCGTGTGCAGC
AIFM1-shRNA: TACTGGCATCAGTCAATGTTCTGGAGTGA
shCont: GCACTACCAGAGCTAACTCAGATAGTACT
Using Lenti-Pac expression packing kit (Genecopoeia, Rockville, MD, USA) lentiviruses carrying shRNAs were made in Lenti HEK-293Ta cells according to the manufacturer’s instructions. HT-29 and CaCo-2 cells were transduced by these viruses and puromycin selection (0.3 μg/mL for HT-29 and 0.15 μg/mL for CaCo-2 cells) was carried out in order to make the stable cell lines. Scrambled shRNA sequence was used as a negative control for shRNA-targeted experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!