The largest database of trusted experimental protocols

13 protocols using srsf1

1

Comprehensive Antibody Panel for Splicing Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used: AFB1 (Santa Cruz, no. sc-393403), SAFB2 (Santa Cruz, no. sc-514963), SAFB1/2 (HET) (human: Merck/Sigma-Aldrich, no. sc05-588; mouse: LSBio, no. LS-C2886411), SLTM (Invitrogen, no. PA5-59154), ORF1p (human: abcam, no. ab230966; mouse: abcam, no. ab216324), TASOR (Sigma-Aldrich, no. HPA006735), 1H4 (p-SR) (Merck/Sigma-Aldrich, no. MABE50), RBM12B (Bethyl, no. A305-871A-T), RBMX (Cell Signaling Technology, no. 14794 S), NCOA5 (Bethyl, no. A300-790A-T), ZNF638 (Sigma-Aldrich, no. ZRB1186), ZNF326 (Santa Cruz, no. sc-390606), TRA2B (Bethyl, no. A305-011A-M), U2AF2 (U2AF65; Santa Cruz, no. sc-53942), TUBULIN (Santa Cruz, no. sc-32293), SRRM1 (abcam, no. ab221061), SRRM2 (SC35) (Sigma-Aldrich, no. S4045), SON (Sigma-Aldrich, no. HPA023535), DHX9 (abcam, no. ab183731), U1-70K (SySy, no. 203011), PRP8 (Santa Cruz, no. sc-55533), RNAPII (Creative Biolabs, no. CBMAB-XB0938-YC), IgG normal mouse (Santa Cruz, no. sc-2025), SRSF1 (Santa Cruz, no. sc-33652), SRSF2 (abcam, no. ab204916), SRSF3 (Elabscience, no. E-AB-32966), SRSF7 (MBL, no. RN079PW), RB1 (Cell Signaling Technology, no. 9309 S), TRA2B (Santa Cruz, no. sc-166829) and YTHDC1 (Proteintech, no. 14392-1-AP).
+ Open protocol
+ Expand
2

RIP-ChIP Protocol for Protein-RNA Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The protocol was adapted from the RIP–ChIP protocol described previously45 (link). Briefly, protein A Sepharose beads (Sigma) were coated with 3 µg of U1 snRNP, SF3B1, SRSF1, U2AF2 or mouse IgG antibody (Santa Cruz), followed by incubation with 2 mg of Hep3B or SNU398 total cell lysates overnight. The RNA–protein–bead complexes were washed once with NT2 crowders (25 mg Ficoll PM400 (GE Healthcare), 75 mg Ficoll PM70 (GE Healthcare) and 2.5 mg dextran sulfate (Fluka) in 10 ml of NT2 buffer) and five times with NT2 buffer (50 mM Tris pH 7.0, 150 mM NaCl, 1 mM MgCl2 and 0.05% (v/v) NP-40). Protein–RNA complexes were collected in 100 μl of NET2 buffer (1 mM DTT, 16.7 mM EDTA, 200 U RNaseOUT (Thermo Fisher) and 100 U SUPERase In (Ambion) in 1× NT2 crowder), supplemented with 100 μl of 2× SDS–TE (100 mM Tris pH 7.5, 10 mM EDTA pH 8.0 and 1% SDS). RNA was isolated using TRIzol reagent and subsequently purified with phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1).
+ Open protocol
+ Expand
3

Comprehensive Immunoblotting Antibody Panel

Check if the same lab product or an alternative is used in the 5 most similar protocols
ADAR1(Santa Cruz Biotechnology, sc-73408), alpha-Tubulin (Santa Cruz Biotechnology, sc-32293), COIL (Cell Signaling Technology, D2L3J, #14168), DHX9 (Abcam, ab183731), FLAG-M2 (Sigma, F3165), GFP (Chromotek, PAGB1), Myc-tag (Cell Signaling Technology, 9B11, #2276), Phospho-Rpb1 CTD (Ser2) (Cell Signaling Technology, E1Z3G, #13499), PNN (Abcam, ab244250), RBM25 (Sigma, HPA070713-100UL), SC-35 (Sigma, S4045), SRSF1 (SF2/ASF, Santa Cruz Biotechnology, sc-33652), SON (polyclonal rabbit, Sigma, HPA023535), SRRM1 (Abcam, ab221061), SRRM2 (Thermo Fisher Scientific, PA5-66827), SRSF2 (Abcam, ab28428), SRSF7 (MBL, RN079PW), U1-70K (Santa Cruz Biotechnology, sc-390899), U2AF65 (Santa Cruz Biotechnology, sc-53942).
+ Open protocol
+ Expand
4

Co-Immunoprecipitation of SRSF1, EIF3B, TIA1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Co-immunoprecipitation (co-IP) using PANC-1 cell lysate and antibody of SRSF1 (Santa Cruz, sc-33,652), EIF3B (Santa Cruz, sc-137,214), TIA1 (Santa Cruz, sc-166,247), GAPDH (ProMab, 20,035), and IgG (Santa Cruz sc-2025) was performed as described previously [33 (link)], and the protein complex was detected by western blot.
+ Open protocol
+ Expand
5

ChIP-qPCR analysis of HIV-1 transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells transfected with the indicated plasmids. At 48 h post-transfection cells were cross-linked in 1% formaldehyde and ChIP was performed as previously described (22 (link)) utilizing the following antibodies RNAPII (Millipore, clone CTD4H8), RNAPII Phospho Ser2 (AbCam, #ab24758), GFP (Santa Cruz Biotechnology, #sc-9996), SRSF1, Cyclin T1 (Santa Cruz Biotechnology, sc-10750) or normal rabbit immunoglobulin G (IgG) (Cell Signaling Technologies, #2729). The green fluorescent protein (GFP) antibody was utilized to precipitate the product of the pTat-GFP construct. The data collected were derived from three independent experiments and quantified by qPCR assays carried out with primer pairs specific for the LTR promoter (TAR_Fb: GGAACCCACTGCTTAAGCCT; TAR_Rb: GGATCTCTAGTTACCAGAGT) and the open reading frame (ORF) (RF21.21: TTCTTCAGAGCAGACCAGAGC; RF20.22: GCTGCCAAAGAGTGATCTGA) utilizing a Stratagene Mx3005P and analyzed with MxPro V3.0 software. The data sets were normalized to input values and results expressed as fold enrichment over the IgG control. Data are represented as means ± SEM.
+ Open protocol
+ Expand
6

Western Blotting Procedure for Protein Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in RIPA lysis buffer (50 mM Tris-HCl pH7.5, 1% NP-40, 0.5 mM EDTA, 0.1% SDS, 150 mM NaCl, 0.5% Sodium deoxycholate) with PMSF (Beyotime, China). Cell lysate was centrifuged at 14,000 rpm for 10 min at 4°C. The protein concentration was measured by BCA assay (Beyotime, China). The protein samples were separated by 15% SDS-PAGE, and then transferred to polyvinylidene fluoride (PVDF) membranes (PALL, USA). Membranes were blocked in TBST with 5% nonfat milk and then incubated with primary antibodies at 4 °C overnight. After washing with TBST, the membranes were incubated with corresponding secondary antibodies for 1h at room temperature. Following a triple washing step with TBST, the bands were visualized with the chemiluminescence method (Millipore, USA). Antibodies including β-actin, GAPDH, hnRNP A1, SRSF1 and HRP-conjugated anti-rabbit or anti- mouse secondary antibodies were purchased from Santa Cruz (USA).
+ Open protocol
+ Expand
7

Western Blot Analysis of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in Laemmli buffer and analyzed for total protein concentration. 20 μg of total protein from each cell lysate was separated by SDS-PAGE and transferred on to a PVDF membrane. The membranes were blocked with 5% milk and probed with specific antibodies. Bands were visualized using enhanced chemiluminescence detection. Primary antibodies: β-Catenin (1:2000, Sigma), Phospho-MEK S217/221 (1:1000, Cell Signaling), total MEK (1:1000, Cell Signaling), phospho-ERK T202/Y204 (1:1000 Sigma), total ERK1/2 (1:1000, Cell Signaling), phospho-AKT (1:1000, Cell Signaling), AKT (1:1000, Cell Signaling), cleaved Caspase 3 (1:1000, Cell Signaling) SRSF1 (AK96 culture supernatant 1:300), CUGBP1 (1:1000, Santa Cruz Biotechnology), MBNL1 (1:250, Santa Cruz Biotechnology), SRSF3 (1:1000, Santa Cruz Biotechnology). Secondary antibodies: HRP-conjugated goat anti-mouse, goat anti-rabbit and donkey anti-goat IgG (H+L; 1:10000 Jackson Laboratories).
+ Open protocol
+ Expand
8

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Equal amounts (10–30 mg) of protein extracts from cerebral tissues or cells were loaded and separated by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) using 8–12% acrylamide gradients. Following electrophoresis, separated proteins were transferred electrophoretically to a polyvinylidene difluoride (PVDF) membrane (Amersham Biosciences, Piscataway, NJ, USA). Non-specific proteins were blocked by incubating the membrane in blocking buffer (5% non-fat dry milk in T-TBS containing 0.05% Tween 20) overnight. The membranes were incubated with the indicated primary antibodies against Pnn (P3A, 1:1000, a kind gift from Prof. Pin Ouyang), SRSF1 (1:500, Santa Cruz, Santa Cruz, CA, USA), SRSF2 (1:500, Santa Cruz, Santa Cruz, CA, USA), GR (1:1000, Abcam, Cambridge, MA, USA), GPx (1:500, Abcam, Cambridge, MA, USA), HO-1 (1:1000, Sigma, St. Louis, MO, USA), NQO-1 (1:500, Abcam, Cambridge, MA, USA), NOX-1 (1:2000, St. Louis, MO, USA), NOX-2 (1:1000, St. Louis, MO, USA), p21 (1:500, Santa Cruz, CA, USA), TGF-β (1:500, Abcam, Cambridge, MA, USA), and actin (1:1000, Cell Signaling, Danvers, MA, USA) for 1 h at room temperature. Signals were detected with HRP-conjugated goat antimouse or goat ant-rabbit with ECL (Perkin Elmer, Waltham, MA, USA).
+ Open protocol
+ Expand
9

Immunofluorescent Staining of Murine Palatal Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Murine palatal shelf tissues of E13.5, E14.5, and E16.5 were dewaxed in xylene, and then dehydrated in ethanol. The tissues were then incubated in solutions containing specific primary antibodies: EIF3H (1:100, Santa Cruz, sc-271283), SRSF1 (1:100, Santa Cruz, sc-33652), and RBBP6 (1:100, Santa Cruz, sc-9962) (Table S3) followed by incubation in Alexa fluor 488-labeled goat anti-mouse secondary antibodies (1: 50, Beyotime, A0428).
+ Open protocol
+ Expand
10

Immunohistochemical Analysis of NSCL/P

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hematoxylin and eosin (H&E) staining was performed according to the manufacturer’s instructions. In brief, human sample tissues of NSCL/P were immersed in 4% paraformaldehyde for 48 h. Next, the fixed tissues were dehydrated, cleared, and embedded in paraffin wax. The paraffin blocks were cut into 4-μm-thick sections and stained with hematoxylin and eosin (H&E). Primary antibodies against the following proteins were used: EIF3H (1:100, Santa Cruz, sc-271283), SRSF1 (1:100, Santa Cruz, sc-33652), and RBBP6 (1:100, Santa Cruz, sc-9962) (Table S3). Briefly, tissues were fixed, dehydrated, embedded, and sectioned for each sample for all stains. Sections were incubated with primary antibodies, washed, and then incubated with appropriate secondary antibodies (MaxVision, kit-5020, China). Optical microscopy (Thermo Scientific, Wilmington, USA) was used to image stained sections. Semi-quantitative analysis was performed using Fiji v2.9.0 (NIH, Bethesda).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!