Rictor

Cells were reverse transfected with siRNA using Dharmacon Human siGENOME siRNA: cyclin D1 (M-003210-05-0005), cyclin E1 (M-003213-02-0005), Raptor (L-004107-00-0005), Rictor (L-016984-00-0005) and non-targeting siRNA (D-001810-10-05) or CDK2 (ID# 103569) and CDK4 (ID# 103747) from Thermo Fisher. Transfection was performed using Lipofectamine RNAiMax Transfection Reagent (Invitrogen, 13778150) according to manufacturer’s protocol. Following 24-hour transfection, cells were incubated with palbociclib or vehicle control at the concentration and times indicated. Proliferation was determined using a chemiluminescent BrdU ELISA assay (Sigma 11669915001) as described by the manufacturer. Luminescence was read on a BioTek Synergy 2 plate reader. Parallel experiments were performed using immunoblot analysis in which cells were exposed to 200 nM palbociclib up to 48-hour following reverse transfection.

Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical cords obtained from local hospitals under the University of California, Irvine, Institutional Review Board approval and were cultured as previously described [4 (link)]. Normal human lung fibroblasts (NHLFs) were purchased from Lonza and cultured in M199 containing 10% FBS. Human cardiac microvascular endothelial cells (HMVECs) were purchased from Lonza and maintained similarly to HUVEC. The BALB/c colon carcinoma cell line CT26.WT (ATCC) was cultured in RPMI (Life Technologies) supplemented with 10% fetal bovine serum.
HUVEC were transfected with siRNA using Lipofectamine 2000 in Opti-MEM (Invitrogen). The sequences of the siRNA to human raptor and Rictor (Thermo Scientific) are as follows: Raptor 5′GGGAGAAGCUGGAUUAUUUUU3′ and Rictor 5′GGAAAUAAGGCGAGGUCUAUU3′. siRNA targeting Rheb and Sin1 were ON-TARGETplus siRNA from Thermo Scientific. A non-targeting scrambled control siRNA (Thermo Scientific) was used in all experiments to assess sequence independent effects of siRNA delivery. Transfection efficiency was determined by Western blot (see below).