7900ht rt pcr system

Total RNA was extracted from TCMK cells and the cortex of left kidneys with TRIzol reagent following the manufacturer's instructions. For the detection of lncRNA, total RNA was reverse‐transcribed into cDNA by the reverse transcription kit (RR047A, Takara, Japan). Furthermore, for the detection of miRNA, the tailed method was applied, and the NCode^TM miRNA First‐Strand cDNA Synthesis Kit (MIRC10, Invitrogen) was employed to polyadenylate the isolated RNA. The samples were loaded following which the samples were subjected to reverse transcription quantitative polymerase chain reaction (RT‐qPCR) with the 7900 HT RT‐ PCR System (Applied Biosystems, USA). Three replicate wells were set per sample to obtain variable data. Additionally, GAPDH or U6 were used as an internal reference. The following primer sequences were used in the study: miR‐144‐3p, forward 5’‐GCTG GGATATCATCATATACTG‐3’ and reverse 5’‐CGGACTAGTACATCATCTATACTG‐3’; TUG1, forward 5’‐GGCACCCAGTGTAAAGCA‐3’ and reverse 5’‐AAGCAGCAGATAACAGAGTTG A‐3’; GAPDH, forward 5’‐GTCAACGGATTTGGTCTGTATT‐3’ and reverse 5’‐AGTCTTCTGG GTGGCAGT‐3’; U6, forward 5’‐CTCGCTTCGGCAGCACATA‐3’ and reverse 5’‐AACGATTC ACGAATTTGCGT‐3’.

TaqMan low-density RT PCR arrays (Applied Biosystems) were designed to determine expression of the selected genes. Total RNA (0.5 μg) extracted was reverse transcribed with 200 U Superscript II RT (Invitrogen) and 250 ng random hexamers. A reaction mix containing 75 ng of cDNA and 50 μl of 2× PCR Master Mix (Euregentec) was added to a TaqMan microfluidic card. Reverse transcription and rt PCR was performed in a 7900HT RT PCR System (Applied Biosystems). The cycling program used was 50°C for 30 min, 94.5°C for 15 min, then 40 cycles of 96°C for 30 s and 59.7°C for 1 min. The expression level of each gene was measured in triplicate, and a panel of reference genes (ACTB, B2M, GAPDH, GUSB, HMBS, HPRT1, IPO8, PGK1, POLR2A, PPIA, TBP, TFRC, UBC, YWHAZ, 18S) was used. The average Ct value of each target gene was normalized against the geometric mean of the Ct values of the 15 reference genes. Relative gene expression was expressed as 2^−ΔCt.

Total RNA from human and mouse islets were prepared as described [20 (link)]. CFTR mRNA expression was measured by RT-qPCR using primers and probes from Taqman mRNA assays (Life Technologies, California, USA). Human CFTR: Hs00357011_m1 expression was normalized against human HPRT1: 4333768 F, while mouse CFTR: Mm00445197_m1 expression was normalized against mouse HPRT1: Mm00446968. RT-qPCR runs were performed for individual batches of human (N = 5) and mouse (N = 5) islets in triplicate wells of 384-well plate on a 7900 HT RT-PCR system (Applied Biosystems, California, USA).

To identify novel GPCRs and determine their relative expression levels in the liver, we performed a screen of whole liver tissue cDNA using a custom sensory receptor TaqMan array card according to the manufacturers protocol (Thermo Fisher). This array was designed to screen for the complete complement of bitter, sweet, and umami TRs, all non-visual Opns, and 44 ORs that are highly likely to be ectopically expressed. The complete list of sensory receptors included in the array is listed in Supplementary Table 1. Briefly, RNA was isolated from male C57BL6 livers using phenol-chloroform extraction and 2 μg of RNA was used to synthesize cDNA using the High Capacity RNA-to-cDNA Kit (Applied Biosystems). Each reservoir in the given Taqman array microfluidic card was filled with 1,000 ng of cDNA and the array cards were run on the 7900 HT- RT-PCR system (Applied Biosystems) and analyzed using the SDS software. Each gene was run in triplicate and ΔCt values for each receptor was calculated using 18s ribosomal RNA. The initial screen was intended to identify the complete complement of sensory receptors expressed in murine liver and as such, standard deviation was not determined (n = 2 livers).