The SMARTTM RACE cDNA Amplification Kit (Clontech, America) was used to clone the full-length cDNA of different members of the LRR-RLK gene family from the cDNA mixture of IGV1-465 at 1, 6, 12, 24, 36, 48 and 72 hours after inoculation (hai) according to the manufacturer’s instructions. Primers for 5’-RACE (LRR-RLK-5’ out and LRR-RLK-5’ inner) and 3’-RACE (LRR-RLK-3’) are described in Additional file 1 : Table S1. Two pairs of primers (LRR-RLK1-QC-F/R and LRR-RLK2-QC-F/R) were designed based on the sequence of the 5’and 3’cDNA ends and used to obtain the full length cDNA of TaRLK1 and TaRLK2 (Additional file 1 : Table S1). The PCR products were cloned into the pGEM-T Easy Vector (Takara, Japan) and sequenced by BGI (China).
Pgem t easy vector
Manufactured by Takara Bio
Sourced in China, Japan, United States
The PGEM-T Easy Vector is a linear plasmid vector designed for the efficient cloning of PCR products. It provides a convenient system for the direct insertion and efficient expression of PCR amplified DNA fragments.
Automatically generated - may contain errors
Lab products found in correlation
Escherichia coli dh5α cells, by Takara Bio (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Smart race cdna amplification kit, by Takara Bio (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Gel extraction kit, by Omega Bio-Tek (1 mentions)
Dna clean up kit, by CWBIO (1 mentions)
Ex taq, by Takara Bio (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (1 mentions)
In fusion cloning, by Takara Bio (1 mentions)
Hek293 cell line, by American Type Culture Collection (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
T4 dna ligase, by Takara Bio (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Pcdna3.1 v5 his, by Thermo Fisher Scientific (1 mentions)
Pegfp n1, by Takara Bio (1 mentions)
Pcmv myc n vector, by Takara Bio (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
15 protocols using pgem t easy vector
1
Cloning LRR-RLK Gene Family Transcripts
2
Cloning and Phylogenetic Analysis of OoNAC72
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of OoNAC72 was obtained by our research group from the O. ochrocephala’s transcriptome sequencing data (He et al., 2015 (link)). Using the specific primers, we amplified the ORF of OoNAC72 (Supplementary Table S1 ). The PCR condition was as follows: 3 min at 95°C; 34 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C; and then 10 min at 72°C. The resulting PCR products were cloned to the pGEM-T Easy Vector (TaKaRa, Beijing, China) and sequenced by Sangon Biotech Co., Ltd., (Shanghai, China). Multiple sequence alignment of OoNAC72 with NAC TFs in other species was performed with DNAMAN 8.0. A phylogenetic tree was constructed using a neighbor-joining (NJ) method with 1000 bootstrap replicates in MEGA 5.0.
3
Inactivated HPV58 E6E7 Fusion Vaccine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPV58 E6 and E7 genes were modified to inactivate their transforming activity and then fused into one reading frame. According to the literature, the amino acids mutations at 50L, 63C, and 106C in E6 have been shown to remove the ability to degrade p53 and inactivate its oncogenic activity,19 (link),20 (link) and the E7 amino acids at positions 24C, 26E, and 92C were mutated to abolish retinoblastoma (Rb) binding and degradation.20 (link)–22 (link) For all mutations, the wild-type amino acids were mutated to glycine. In addition, for vaccine plasmid transcription, the E6 and E7 mutations were deleted their termination signal and fused into one reading frame without altering their amino acid sequences. The modified HPV58 E6E7 fusion gene was named mE6E7. The HPV58 mE6E7 fusion fragment was commercially synthesized (Qingke Biologic Technology Company, Beijing, People’s Republic of China) and cloned into the pGEM-T easy vector (Takara, Dalian, People’s Republic of China) to generate the pGEM-T easy-HPV58 mE6E7 plasmid. The presence of the HPV58 mE6E7 gene in the plasmid was verified by sequencing analysis.
4
Quantitative Detection of PCV2 DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viral DNA was extracted by using the Colume Viral DNAout Kit (TIANDZ, Beijing, China) according to the manufacturer’s instructions. The total DNA was stored at − 70 °C until use. PCV2 DNA copies was determined by TaqMan-based qPCR. The primers and TaqMan probe specific for PCV2 were designed as follows: forward primer 5’-TAAATCTCATCATG TCCACATTCCA-3′, reverse primer 5’-CGTTACCGCTGGAGAAGGAA-3′ and TaqMan probe 5′-[6-FAM] AATGGCATCTTCAACACCCGCCTCT [TAMRA]-3′. A recombinant pGEM-T easy vector (TaKaRa, China) containing PCV2 genome insert was constructed by us and the qPCR standard curve was generated by analysis of tenfold serial dilutions ranging from 102 to 107 copies. Each 25 μl qPCR reaction was run in triplicate containing 12.5 μl Premix Ex Taq (2×), 0.5 μL of each primer (10 μM), 0.5 μl TaqMan probe (10 μM), 0.5 μl ROX Reference DyeII (50×), 1 μl of DNA template, and 9.5 μl of deionized water. qPCR was performed on 7500 Real-Time PCR Systems (Applied Biosystems, USA) by using the following thermal cycles: 95 °C for 30 s, 40 cycles at 95 °C for 5 s, and 60 °C for 34 s.
5
Cloning and Sequencing of Cytochrome P450 Genes in N. lugens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before extracting the total RNA, all treated N. lugens nymphs were stored at −80°C in an ultra-low temperature freezer. The method and reagents for extracting the total RNA followed those outlined by Dalian Takara Co., Ltd. (Liaoning, China). The first strand of cDNA was synthesized with 500 ng total RNA and PrimeScriptTM RT reagent Kit (Takara Co., Ltd., Liaoning, China). Paired primers (10 nM) were designed and used to clone two 383 and 420 bp fragments of the target genes CYP4G76 and CYP4G115, respectively. The green fluorescent protein (GFP, GenBank: AF372525.1) with an 864 bp fragment was used as a control. All primers were shown in Table 1 .
The PCR thermocycler parameter was as follows: (1) 94°C for 3 min; (2) 34 cycles at: 94°C for 30 s, 55°C for 30 s, 72°C for 20 s; and (3) 72°C for 5 min. All reagents were supplied by Takara Co., Ltd. (Dalian, Liaoning, China). The target fragments were retrieved from 1.0% agarose gel with Gel Extraction Kit (OMEGA Bio-tek, Norcross City, Georgia, United States), and were then cloned in pGEM-T Easy Vector (Takara Co., Ltd., Dalian, Liaoning, China), according to product manual. All positive clones for CYP4G76 and CYP4G115 were corroborated by DNA sequencing (Biosune Co., Ltd., Shanghai, China).
The PCR thermocycler parameter was as follows: (1) 94°C for 3 min; (2) 34 cycles at: 94°C for 30 s, 55°C for 30 s, 72°C for 20 s; and (3) 72°C for 5 min. All reagents were supplied by Takara Co., Ltd. (Dalian, Liaoning, China). The target fragments were retrieved from 1.0% agarose gel with Gel Extraction Kit (OMEGA Bio-tek, Norcross City, Georgia, United States), and were then cloned in pGEM-T Easy Vector (Takara Co., Ltd., Dalian, Liaoning, China), according to product manual. All positive clones for CYP4G76 and CYP4G115 were corroborated by DNA sequencing (Biosune Co., Ltd., Shanghai, China).
6
Genomic DNA Extraction and Defensin Gene Amplification from Scorpion Martensii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated as previously described [31 (link)]. Simply intact individuals of the scorpion M. martensii were washed three times with 75% ethanol and grounded to fine powder in liquid nitrogen. Then genomic DNA extraction was performed using TIANamp Genomic DNA Kit (Tiangen, China) according to the manufacturer’s instructions.
Primers (Supplementary Table S1) from 5′-UTR and 3′-UTR regions of the predicted defensin genes from the scorpion M. martensii genome were picked up to amplify the corresponding genomic DNA by PCR. Amplification was performed with one cycle of 5 min at 95°C, 30 cycles of 40 s at 95°C, 40 s at 58°C, 150 s at 72°C, and a final cycle of 10 min at 72°C using Ex Taq (TaKaRa, China). PCR products were purified using the DNA Clean-up Kit (CWBio, China) and ligated to pGEM-T Easy Vector (TaKaRa, China). Sequencing was performed by Tsingke Biological Technology.
Primers (Supplementary Table S1) from 5′-UTR and 3′-UTR regions of the predicted defensin genes from the scorpion M. martensii genome were picked up to amplify the corresponding genomic DNA by PCR. Amplification was performed with one cycle of 5 min at 95°C, 30 cycles of 40 s at 95°C, 40 s at 58°C, 150 s at 72°C, and a final cycle of 10 min at 72°C using Ex Taq (TaKaRa, China). PCR products were purified using the DNA Clean-up Kit (CWBio, China) and ligated to pGEM-T Easy Vector (TaKaRa, China). Sequencing was performed by Tsingke Biological Technology.
7
Molecular Characterization of Environmental Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR product was purified using a GeneJET PCR Purification Kit (Fermentas, USA). Purified PCR products were ligated into a pGEM–T Easy vector, transformed into DH5α Escherichia coli cells following the manufacturer’s instructions (Takara Bio Inc., Japan) and sequenced at Majorbio Bio-Pharm Technology Co. (Shanghai, China). All sequences were checked for chimeric artifacts using the Mallard program. Clones with more than 97% sequence similarity were grouped into the same operational taxonomic unit. The representative sequences were compared to those available in the GenBank databases using the basic local alignment tool nucleotide (BLASTN) through the National Center for Biotechnology Information server. The bacterial 16S rRNA gene sequences and fungal 18S rRNA gene sequences obtained were deposited in GenBank under accession numbers KU514494 to KU515401 and KU515483 to KU515952, respectively. Phylogenetic trees were
constructed with the neighbor-joining method using MEGA 4.044 (link). Bootstrap resampling analysis for 1000 replicates was performed to estimate the confidence of the tree topologies.
constructed with the neighbor-joining method using MEGA 4.044 (link). Bootstrap resampling analysis for 1000 replicates was performed to estimate the confidence of the tree topologies.
8
Endogenous TDP43 gene tagging in HEK293 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mammalian cell culture experiments were performed using the HEK293 cell line (American type culture collection). For site-specific integration of the 3×Flag-GFP into the endogenous TDP43 locus, three sgRNAs were designed to target regions close to the TDP43 start codon and cloned into pGuide-it vector (TaKaRa) using published methods (36 (link)). To construct the donor vector, ∼1,000-bp homologous arms located upstream or downstream from the TDP43 start codon were amplified by PCR. The 3×Flag-GFP sequence was also PCR amplified. The three DNA pieces, upstream of TDP43 start codon, 3×Flag-GFP, and downstream, were introduced into pGEM-T Easy vector by In-Fusion cloning (TaKaRa). HEK293 cells were cotransfected with the donor vector and small guide RNAs using Lipofectamine 2000 (Thermo Fisher Scientific). Posttransfection, cells were split at low density to allow formation of single colonies. GFP-positive colonies containing properly inserted 3×Flag-GFP were screened by anti-Flag Western blotting and confirmed by DNA sequencing.
9
Cloning and Sequencing of Insect Serpin Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To amplify gene-specific primers, cDNA and a set of sense and anti-sense primers were used in PCR. For the digestion reaction, sense primer was incorporated into the BamHI restriction site, whereas to incorporate anti-sense primer, the KpnI restriction site was used. The PCR amplification was performed as follows: denaturation at 95 ºC for 3 min, followed by 35 cycles at 95 ºC for 30 sec, 55 ºC for 30 sec, and 72 ºC for 2 min, with a final extension at 72 ºC for 5 min. The PCR product was then visually examined on a 1% (w/v) agarose gel stained with ethidium bromide using the BioRad imaging system. A gel extraction kit (Omega) was used to purify the amplified product, which was then ligated to the pGEM-T easy vector (TaKaRa) and transformed into Escherichia coli DH5α. A positive clone was selected on LB agar plates that contained 50 μg mL-1 ampicillin after incubation at 37 ºC overnight. The resulting clones were sequenced by Shanghai Sunny Biotech Co., Ltd. Triplicates were used for sequencing, and all the sequences were determined in both directions for at least 9-12 clones, and only those cloned PCR products showing high similarity with other serpin genes from insects were selected.
10
Amplification and Cloning of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To amplify gene-specific primers, cDNA and a set of sense and antisense primers were used in PCR (Table 1).
For the digestion reaction, sense primer was incorporated into the BamHI restriction site, whereas to incorporate antisense primer, the KpnI restriction site was used. The amplification by PCR had the following steps: denaturation at 95 °C for 3 min, then 35 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min, with a final extension at 72 °C for 5 min. The PCR product was visually examined on a 1% (w/v) agarose gel stained with ethidium bromide using the Bio-Rad imaging system. The gel extraction kit (Omega) was used to purify the target gene-amplified product. The purified product was then ligated to pGEM-T easy vector (Takara) and transformed into Escherichia coli bacteria DH5α. A positive clone was then selected on LB agar plates that contained 50 μg mL -1 ampicillin after incubation at 37 °C overnight. The resulting PCR clones were sequenced by Shanghai Sunny Biotech Co., Ltd.
For the digestion reaction, sense primer was incorporated into the BamHI restriction site, whereas to incorporate antisense primer, the KpnI restriction site was used. The amplification by PCR had the following steps: denaturation at 95 °C for 3 min, then 35 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min, with a final extension at 72 °C for 5 min. The PCR product was visually examined on a 1% (w/v) agarose gel stained with ethidium bromide using the Bio-Rad imaging system. The gel extraction kit (Omega) was used to purify the target gene-amplified product. The purified product was then ligated to pGEM-T easy vector (Takara) and transformed into Escherichia coli bacteria DH5α. A positive clone was then selected on LB agar plates that contained 50 μg mL -1 ampicillin after incubation at 37 °C overnight. The resulting PCR clones were sequenced by Shanghai Sunny Biotech Co., Ltd.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!