We searched the BspJ gene sequence in the Genbank database. Primer 5.0 was employed to design the primers used to amplify the target fragment (BspJ-F 5′-ATGAAGAGCTTGCAGTTTTC-3′, BspJ-R 5′-TTATCGATATGCCCGAGGTAC-3′). Brucella abortus was used to as a genome template for BspJ gene cloning. The C-terminal fusion His tag of the BspJ gene constructed to pDsRed2-C1 (Clontech, United States) and pcDNA3.1 (Invitrogen, United States) vectors. Using an endotoxin-free plasmid large-scale extraction kit (TIANGEN, China) to extract the plasmids pDsRed2-C1-BspJ and pcDNA3.1-BspJ. Meanwhile, the BspJ gene was constructed into the vector pGBKT7 (Clontech, United States).
Pdsred2 c1
Manufactured by Takara Bio
Sourced in United States
PDsRed2-C1 is a fluorescent protein derived from the sea anemone Discosoma species. It is an improved variant of the DsRed protein, with enhanced brightness and faster maturation. PDsRed2-C1 can be used as a fluorescent marker for various biological applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Puromycin, by Merck Group (1 mentions)
Transit 293, by Mirus Bio (1 mentions)
Pegfp c1, by Takara Bio (1 mentions)
Pcmv myc, by Takara Bio (1 mentions)
Pet32a, by Takara Bio (1 mentions)
Endotoxin free plasmid large scale extraction kit, by Tiangen Biotech (1 mentions)
Pcdna3, by Takara Bio (1 mentions)
Pgbkt7, by Takara Bio (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Geneart site directed mutagenesis system, by Thermo Fisher Scientific (1 mentions)
Rapamycin, by Merck Group (1 mentions)
Pegfp n3, by Takara Bio (1 mentions)
Pcmv flag, by Takara Bio (1 mentions)
Rabbit polyclonal anti lc3b antibody, by Abcam (1 mentions)
Horseradish peroxidase hrp conjugated goat anti rabbit igg, by Merck Group (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
9 protocols using pdsred2 c1
1
Cloning and Expression of BspJ Gene
2
Establishing Stable BLM-expressing Cell Lines
3
Plasmid Constructs for Fluorescent Protein-Fused Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pDsRed2-fused IPO13 for mammalian cell expression of IPO13 fused to the DsRed2 fluorescent protein was constructed by digestion of plasmid vector pDsRed2-C1 (Clontech, Mountain View, CA, USA), and insertion of polymerase chain reaction (PCR) generated IPO13 insert at EcoRI and SmaI restriction sites. Plasmid for mammalian expression of GFP-fused IPO13 was generated as described previously4 (link). Plasmid for mammalian cell expression of the fusion protein GFP-KLF4 was constructed by inserting PCR amplified sequences encoding full-length mouse KLF4 in-frame into the BamHI and HindIII restriction sites of plasmid pEGFP-C1 C-terminal to the coding sequence of eGFP. The plasmid for mammalian cell expression of GFP-SP1 was from Jan-Jong Hung (National Cheng Kung University, Taiwan). The integrity of constructs was verified by DNA Sequencing.
4
Constructing CD30L-DsRed2 and CD30-eGFP Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Construction of the CD30L-DsRed2 plasmid: Human CD30L (CD153, isoform 1) was amplified by PCR from the cDNA of DG75 cells using the BglII forward primer 5′-actcagatct cgagGAATGGACCCAGGGCTGCAGCAA GCA-3′ and the BamHI reverse complement primer 5′-tgagaggatcc TCAGTCTGAATTACTGTATAAGAAGA TGGACA-3′ to clone the PCR product into the BglII and BamH1 restricted expression vector pDsRed2-C1 (Clontech, CA). Construction of the CD30-eGFP expression plasmid: The CD30 cDNA was amplified from CD30-pcDNA3 plasmid [46 (link)] using the HindIII forward primer 5′-gcgagaagctt ATGCGCGTCCTCCTCGCCGCG-3′ and the BamHI reverse complement primer 5′-tcgtaggatcc CCCTTT CCAGAGGCAGCTGTGGG-3′. This PCR product was cloned into the HindIII/BamHI restricted plasmid pEGFP-C1 (Clontech CA).
5
Plasmid Construction for Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For expression plasmid construction, the open reading frame (ORF) cDNA of the RGNNV CP (GenBank accession No.: KP455642) was amplified by polymerase chain reaction (PCR) and cloned into thepCMV-Flag, pCMV-Myc, pDsRed2-C1, and pET-32a (+) vectors, which were acquired from Clontech (USA). The coding regions of LjHSP90ab1 were cloned intopCMV-Flag,pCMV-Myc, and pET-32a (+) vectors, respectively. The L. japonicus AKT gene was cloned into pCMV-Flag and pCMV-Myc vectors, respectively. The L. japonicus and marine medaka LC3 genes were cloned into the pEGFP-N3 vector, respectively. Serially truncated mutants of LjHSP90ab1 with Flag-tag, including pCMV-Flag-LjHSP90ab1-NC, pCMV-Flag-LjHSP90ab1-NM, pCMV-Flag-LjHSP90ab1-MC, pCMV-Flag-LjHSP90ab1-M, pCMV-Flag-LjHSP90ab1-C, and pCMV-Flag-LjHSP90ab1-N, were generated using thepCMV-Flag-LjHSP90ab1 plasmid as a template. Serially truncated mutants of CP with Flag-tag, includingpCMV-Flag-CP-ΔARM, pCMV-Flag-CP-Δarm, pCMV-Flag-CP-ΔS,pCMV-Flag-CP-ΔLR, and pCMV-Flag-CP-ΔP plasmids, were generated using thepCMV-Flag-CP plasmid as a template. The PCR specific primers used are shown in Supplementary Table S1. The expression plasmids were all constructed using standard molecular biology techniques and examined via DNA sequencing (Hopp et al., 1988 (link)).
6
Peptide Modulation of Cell Migration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 8
The plasmid vector pDsRed2-C1 (Clontech), which expresses a fluorescent protein (DsRed2), was transfected into cells. The cells were plated on a glass plate, and observed under the microscope at 1-hour intervals in the presence of partial peptide p6 (5 μM) while measuring the displacement on a display. The observation was carried out for 12 to 37 cells. Statistical analysis was carried out by unpaired Student t-test in order to analyze a significant difference.
An experiment was carried out in the same manner as in Experimental Example 8-1 except that partial peptide p1 (5 μM) was used instead of partial peptide p6.
An experiment was carried out in the same manner as in Experimental Example 8-1 except that no partial peptide was added.
[Results]
7
Generation of Lamin A Fusion Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An expression plasmid, encoding a fusion of lamin A and the red fluorescent protein (RFP), was generated by subcloning of the lamin A open reading frame from the template pS65T-lamin A (kindly provided by Dr. J. Broers, Cardiovascular Research Institute, University of Maastricht, Maastricht, The Netherlands) into the destination vector pDsRed2-C1 (Clontech Laboratories) by cleavage with EcoRI/BamHI. In addition, expression constructs coding for mutant lamin A carrying a single amino acid exchange of serine 22 to alanine (Ser22Ala) or glutamic acid (Ser22Glu) were generated using the GeneArt Site-Directed Mutagenesis System (Thermo Fisher Scientific) according to the manufacturer’s protocol. Site-directed mutagenesis PCR was performed with pDsRed2-C1 lamin A as a template and oligonucleotide primers with nucleotides differing from the wild-type sequence; sequences of oligonucleotides purchased from Biomers (Ulm, Germany) are given in supplemental S1 Table . An expression plasmids coding for FLAG-tagged HCMV kinase pUL97 was described previously [56 (link)]. Transfection of these expression plasmids into wt HeLa and Pin1 KO HeLa cells was performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol.
8
Autophagy Regulation in Grass Carp Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Grass carp LC3B was subcloned into pEGFP-N3 (Clontech, Mountain View, CA, USA) to generate GFP-LC3B to detect the formation of autophagy. Grass carp ATG5 was subcloned into pCMV-FLAG, pDsRed2-C1, and pEGFP-N3 (Clontech, Mountain View, CA, USA ) to generate FLAG-ATG5, DsRed-ATG5, and GFP-ATG5 to overexpress ATG5 in CIK cells. The plasmids were constructed as described previously [30 (link),31 (link)] Then, these vectors (500 ng/µL) were transfected into CIK cells by Lipofectamine™ 3000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s recommendations. Rapamycin, 3-MA, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG were purchased from Sigma (Saint Louis, MS, USA). Rabbit polyclonal anti-LC3B antibody was purchased from Abcam (Cambridge, UK). Rabbit polyclonal SQSTM1/P62 antibody was purchased from Beyotime (Shanghai, China). Lyso-Tracker Red fluorescent probe was purchased from Solarbio (Beijing, China).
9
Generating Chimeric Embryos from iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NGFP1 iPSC line (10) was purchased from Stemgent Inc. (Cambridge, MA). NGFP1 iPSCs were injected into BDF1 (C57/ B6 × DBA/1) hybrid blastocysts 94-98 h after hCG injection. A flat-tip microinjection pipette with an internal diameter of 12-15 mm was used for iPSC injection. About 10 cells were placed into the blastocyst cavity, and the injected blastocysts were immediately transferred to recipient females. To construct chimeric fetuses carrying cells stemmed from teratoma-derived iPSCs, tertiary iPSCs (see below) were transfected with pDsRed2-C1 (Takara Clontech, Otsu, Japan) plasmids using Nucleofector (Lonza, Basel, Switzerland), and those iPSC colonies that survived drug selection and contained red fluorescence signal were pooled before use in blastocyst injection. Twelve to 15 blastocysts were transferred to the uterine horn of a pseudopregnant BDF1 mouse at 2.5 days post coitum. Secondary MEFs were isolated as described previously (10) . Briefly, chimeric embryos were collected at E13.5, and the head and internal organs were removed. The remaining carcass was physically dissociated and incubated in trypsin at 37°C for 20 min. Dissociated cells were resuspended in MEF media containing 2 mg/mL puromycin and expanded for 2 passages before freezing or plating on Dox-containing medium for reprogramming experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!