Recombinant RSV L-P was produced through the co-expression of RSV L and P proteins in a baculovirus expression system, according to previously described procedures (Noton et al., 2012 (link)). The reaction mixture was composed of 0.2 μM modified template sequence (UGCGCUUGUUU), 0.2 μM recombinant RSV L-P polymerase, 200 μM 5′-pACGC primer, buffer (20 mM Tris pH 7.5, 10 mM KCl, 6 mM MgCl2, 2 mM DTT, 0.01% Triton, 10% DMSO), and (α-33P)-GTP with a final volume of 10 μL. The reaction was started through the addition of NTPs, incubated at 30 °C for 30 min, and quenched through the addition of gel loading buffer (Ambion). Samples were run for 1.5 h at 80 W in a 22.5% polyacrylamide urea sequencing gel. The gel was then exposed to a phosphor-screen, and scanned.
Gel loading buffer
Manufactured by Thermo Fisher Scientific
Sourced in United States
Gel loading buffer is a laboratory solution used to prepare DNA or RNA samples for loading into agarose or polyacrylamide gels for electrophoresis. It contains dyes that allow the visualization of the samples during the electrophoresis process and provides density to the samples, enabling them to sink into the wells of the gel.
Automatically generated - may contain errors
Lab products found in correlation
Nupage bis tris gel, by Thermo Fisher Scientific (4 mentions)
Pvdf membrane, by Bio-Rad (4 mentions)
Bradford assay, by Bio-Rad (4 mentions)
Imagequant, by GE Healthcare (2 mentions)
Typhoon phosphorimager, by GE Healthcare (2 mentions)
Rnasin, by Thermo Fisher Scientific (2 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (2 mentions)
Typhoon trio, by GE Healthcare (2 mentions)
Mini protean electrophoresis system, by Bio-Rad (2 mentions)
Type ab human serum, by Euroclone (2 mentions)
Bca assay, by Thermo Fisher Scientific (2 mentions)
Human serum, by Merck Group (2 mentions)
Sybr gold, by Thermo Fisher Scientific (2 mentions)
1 kb ladder, by Thermo Fisher Scientific (1 mentions)
Gotaq flexi buffer, by Promega (1 mentions)
Nuclease free water, by Thermo Fisher Scientific (1 mentions)
Anti tubulin antibody, by Abcam (1 mentions)
Alexafluor 488, by Integrated DNA Technologies (1 mentions)
Escherichia coli uracil dna glycosylase, by New England Biolabs (1 mentions)
C digit blot scanner, by LI COR (1 mentions)
23 protocols using gel loading buffer
1
In Vitro Transcription of RSV L-P
2
Paramyxovirus Polymerase Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Unless otherwise specified, all NiV and RSV polymerase reactions consisted of 0.2 μM oligonucleotide template derived the NiV leader promoter, 0.2 μM recombinant L-P complex, with a buffer containing 20 mM Tris pH 7.5, 10 mM KCl, 2 mM DTT, 0.5% triton, 10% DMSO, 6mM MgCl2. Recombinant RSV L-P was produced through the co-expression of RSV L and P proteins in a baculovirus expression system, according to previously described procedures [23 (link)]. In the primer-dependent reaction, this was then combined with 200 μM primer. Reactions were initiated through addition of specific nucleoside TP for the template sequence to final volume of 10 μL and incubated at 30°C for 30 minutes. The radioisotope tracer in these reactions was α33P-GTP. Reactions were stopped with the addition of an equal volume of gel loading buffer (Ambion, Austin, TX) denatured at 95°C for 5 minutes, and run on a 22.5% polyacrylamide urea sequencing gel for 2 hours at 80W. The migration products were exposed to a phosphor-screen, scanned on Typhoon phosphorimager (GE Healthcare, Chicago, IL) and quantified using ImageQuant (GE Healthcare).
3
In Vitro Transcription of RSV L-P
4
RSV Polymerase Activity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each reaction contained 0.2 μM recombinant RSV L–P, 0.2 μM of an oligonucleotide template sequence derived from the RSV leader promoter (5′ UUUGUUCGCGU 3′) and 400 μM 5′-pACGC primer, mixed in a buffer containing 20 mM Tris-HCl pH 7.5, 10 mM KCl, 2 mM DTT, 0.01% Triton X-100, 10% DMSO, 0.2 U/μL RNasin (Ambion), and 6 mM MgCl2. Reactions were started by adding 100 nM α33P-GTP tracer with specific NTPs as described in the figure legend to a final volume of 10 μL, and incubated for 30 minutes at 30°C. Reactions were quenched by adding an equal volume of gel-loading buffer (Ambion). Samples were denatured at 95°C for 5 minutes and run on a 22.5% polyacrylamide urea sequencing gel for 1.5 hours at 80 W. The gel was dried, exposed to a phosphor screen, scanned on a Typhoon phosphorimager (GE Healthcare), and quantified using ImageQuant (GE Healthcare).
5
Recombinant RSV Polymerase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant RSV polymerase complex was produced by co-expressing the L and P proteins of RSV in insect cells as previously described [25 (link)]. Unless otherwise specified, RNA polymerase reaction samples consisted of 0.2 μM of an oligonucleotide template sequence derived from the RSV leader promoter (5'-UUUGUUCGCGU-3') and 0.2 μM recombinant RSVL-P polymerase together with 200 μM 5'-pACGC primer, mixed in a buffer containing 20 mM Tris pH 7.5, 10 mM KCl, 2 mM dithiothreitol, 0.5% triton, 10% DMSO, 0.2 U/μL RNasin (Ambion), and 6 mM MgCl2. Reactions were started at 30°C by adding specific NTPs in a final volume of 10 μL. The radioisotope tracer used for this assay was α33P-GTP. Reactions were stopped after 30 minutes by adding an equal volume of gel loading buffer (Ambion). Samples were denatured at 95°C for 5 minutes, and run for 1.5 hours at 80 W in a 22.5% polyacrylamide urea sequencing gel. After the gel was dried, the product of migration was exposed to a phosphor-screen and scanned as previously described.
6
Amplification and Verification of Eukaryotic rRNA Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The partial SSU rRNA gene sequence was amplified from each isolate using 50 μL PCR reactions with a final concentrations of 1X Go Taq Flexi Buffer (Promega Corporation, Madison, WI, USA), 5 mmol/L MgCl2, 200umol/L dNTPs, 200 nmol/L 360F (5′‐CGGAGARGGMGCMTGAGA‐3′), and 200 nmol/L EukB (5′‐TGATCCTTCTGCAGGTTCACCTAC‐3′) and 1 unit Taq Polymerase. The PCR reaction consisted of 98°C for 30 sec, followed by 30 repetitions of 98°C for 10 sec, 55°C for 15 sec, and 72°C for 30 sec, followed by a final extension step of 72°C for 7 min. Timing did not allow for SSU rRNA amplifications for the Washington isolates. The D1/D2 region of the eukaryotic LSU rRNA (26S) gene was also amplified, using the same protocol as noted above, with the forward primer NL1 (5′‐TGCTGGAGCCATGGATC‐3′) and reverse primer NL4 (5′‐TAGATACATGGCGCAGTC‐3′). The PCR protocol utilized a 94°C 30 sec initial denaturing step, followed by 30 cycles: 94°C for 30 sec, 52°C for 30 sec, 72°C for 1 min, and a final extension temperature of 72°C for 7 min. PCR products were mixed with gel loading buffer (Ambion), in a 5 to 1 ratio, and were run on a 1% agarose gel with 1X Sybr Safe DNA Gel Stain (Thermo Fisher Scientific, Waltham, MA, USA) along with a 1 kb ladder (Invitrogen, Carlsbad, CA, USA) to confirm the correct size of the amplified PCR product.
7
Polyplex Formation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA (pCMV-GFP, 1 mg/mL, 2.2 μL) was diluted with MilliQ water (34.1 μL), polymer solution (36.3 μL, 3 mg/mL) was added and the solution was mixed to form polyplexes. To achieve various w/w ratios, polymer solutions of 6 to 0.375 mg/mL were used. A free pDNA control was prepared by diluting 0.5 μL pDNA with 16.1 μL MilliQ water. DTT was dissolved in MilliQ water with concentrations ranging from 0.085 to 8500 mM. Hydrazine monohydrate (65%, 18.5 mg) was diluted with MilliQ water (70.9 μL) to form an 8.5 M solution. Heparin sodium salt was dissolved in MilliQ water and diluted to obtain concentrations of 8.5 to 0.0425 mg/mL. A 1.5% w/v agarose (BIO-RAD) gel containing 0.05% v/v SYBR® Safe DNA Gel Stain (Invitrogen™) was prepared in TAE buffer (40 mM tris acetate, 1 mM ethylenediamine tetraacetic acid). Samples were prepared by mixing 7.5 μL transfectant with 1 μL water, DTT, hydrazine or heparin solution. After incubation at room temperature for 30 min., 1.5 μL gel loading buffer (Ambion) was added and the samples were electrophoresed at 75 mA for 30 min. The pDNA was visualized by measuring fluorescence.
8
Protein Extraction and Western Blot Analysis
9
Western Blot Protein Extraction and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed for at least 30 min at 4 °C in RIPA buffer (50
mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium
deoxycholate, 1% NP-40). Lysates were centrifuged for 30 min at
14,000g, and the supernatant was flash-frozen. The total
protein concentration was measured by Bradford assay (Bio-Rad). We boiled 10
µg of protein in gel loading buffer (Life Technologies) with 50 mM of
dithiothreitol and loaded it onto 4–10% BisTris NuPage gels
(Life Technologies). Bands were transferred to PVDF membranes (Bio-Rad), and
then membranes were blocked in 5% BSA/TBST. Blots were then incubated
with primary antibodies for 1 h at room temperature. Proteins were detected with
the LI-COR detection system.
mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% sodium
deoxycholate, 1% NP-40). Lysates were centrifuged for 30 min at
14,000g, and the supernatant was flash-frozen. The total
protein concentration was measured by Bradford assay (Bio-Rad). We boiled 10
µg of protein in gel loading buffer (Life Technologies) with 50 mM of
dithiothreitol and loaded it onto 4–10% BisTris NuPage gels
(Life Technologies). Bands were transferred to PVDF membranes (Bio-Rad), and
then membranes were blocked in 5% BSA/TBST. Blots were then incubated
with primary antibodies for 1 h at room temperature. Proteins were detected with
the LI-COR detection system.
10
Western Blot Protein Extraction and Detection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!