The largest database of trusted experimental protocols

Rt pcr reagents

Manufactured by Qiagen
Sourced in India

RT-PCR reagents are a set of laboratory chemicals and materials used to perform reverse transcription-polymerase chain reaction (RT-PCR) analysis. The core function of RT-PCR reagents is to enable the detection and quantification of RNA molecules by converting them into complementary DNA (cDNA) and then amplifying specific DNA sequences through a series of temperature-controlled cycles.

Automatically generated - may contain errors

4 protocols using rt pcr reagents

1

Endothelial Progenitor Marker Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated, using TRIzol reagent (Thermo Fisher Scientific, Grand Island, NY). An equal amount of total RNA was subjected to cDNA synthesis with the usage of RT‐PCR reagents from Qiagen (Germantown, MD). The SYBR‐green dye was used to quantify the amplicons. The expression levels of different endothelial progenitor markers were assayed using the following primer pairs (given as 5′ to 3′ order): Tek‐F1: GAGTCAGCTTGCTCCTTTATGG,Tek‐R2:AGACACAAGAGGTAGGGAATTGA; KdrF1:TTTGG CAAATACAACCCTTCAGA, Kdr‐R1: GCAGAAGATACTGTCACCACC; Flt4‐F1:ACAGAAGC TAGGCCCTACTG, Flt4‐R1: ACCCACATCGAGTCCTTCCT.
+ Open protocol
+ Expand
2

Efficient Antibody Cloning Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cloning method was adapted from a protocol published by Smith et al (2009)(13 (link)). Briefly, 96-well PCR plates containing sorted plasmablast were thawed and used directly for reverse transcription PCR by the addition of dNTPs, RT-PCR buffer, RNAase-free H2O, reverse transcriptase, and two primer pools containing forward and reverse primers for the heavy and light chains (RT-PCR reagents purchased from Qiagen, primers purchased from Geneart, Invitrogen). These PCR products were used in 3 separate nested PCR reactions to amplify the heavy and light chains separately, and to introduce restriction sites to the ends of the PCR products. Next the PCR products were digested using their respective restriction enzymes (AgeI-HF, SalI, XhoI, and BsiWI, all purchased from New England Biolabs) and ligated into human IgH, IgK, and IgL vectors containing a CMV promotor and ampicillin resistance (all expression vectors were kindly provided by Dr Juthathip Mongkolsapaya) using T4 DNA ligase (New England Biolabs). Vectors were expanded using TOP10 chemically competent E. Coli (Invitrogen), purified using QIAprep Spin Miniprep Kit (Qiagen), and transfected into HEK293/T17 cells in FreeStyle 293 expression medium (Thermo Scientific). Antibody supernatants were collected after 2 days of culture and stored at 4°C for further use.
+ Open protocol
+ Expand
3

Antifungal Susceptibility of C. glabrata Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols
C. glabrata (CG; MTCC 3019) used
in the study was procured from IMTECH (Microbial
Type Culture Collection), Chandigarh, India. C. glabrata clinical isolates (CCG1, CCG2, CCG3, and CCG4) used in this study
were a kind gift from Dr. Navin Kumar, Graphic Era Deemed to be University,
Dehradun, India.79 (link) Clinical isolates of C. glabrata were classified as susceptible (CCG4),
susceptible dose-dependent (CCG2), and resistant (CCG1 and CCG3) according
to interpretive guidelines for in vitro susceptibility testing of Candida species for fluconazole.79 (link) All strains were routinely maintained and cultured in YPD
media (1% yeast extract, 2% dextrose, and 2% peptone; 2% agar for
solid media) at 37 °C. The urinary catheter and eye lens (EtafilconA;
14.0 DIA) were purchased locally. All chemicals used in the study
were procured from Sigma-Aldrich chemicals Ltd and Himedia, India.
RNeasy kit and RT-PCR reagents were purchased from QIAGEN and Applied
Biosystems, respectively. Stock solutions of CIN and EUG were prepared
in dimethyl sulfoxide.
+ Open protocol
+ Expand
4

Quantifying Cardiac α-MHC Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated by using TRIzol reagent. Equal amounts of total RNA was subjected to cDNA with the usage of RT-PCR reagents from Qiagen. The expression levels of a-MHC were assayed using the following primer pair: Forward: 5’ GGAAGAGTGAGCGGCGCATCAAGG 3’ and Reverse:5’ CTGCTGGAGAGGTTATTCCTCG 3’; and the resulting amplicons were resolved on the agarose gels.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!