siRNAs targeting human MLC2 (MYL2; SMART pool, ON-TARGET PLUS, Cat. No.: L-011087000005, siRNAs targeting human FAK (SMART pool, ON-TARGET PLUS, Cat. No.: L-003164000005) were ordered from Dharmacon (Gene Expression and Gene Editing, GE Healthcare, Lafayette, CO, United States). Non-targeting (n.t.) control siRNA (Silencer® Select Negative Control No. 1 siRNA, Cat. No.: 4390843) was purchased from Ambion (Life Technologies, Carlsbad, CA, United States). All siRNAs were re-suspended in RNAse-free water to yield a stock concentration of 20 μM.
On target plus
ON-TARGET PLUS is a proprietary siRNA (small interfering RNA) design and delivery system developed by Santa Cruz Biotechnology. It is designed to provide highly specific and potent gene silencing by targeting the intended gene while minimizing off-target effects.
Lab products found in correlation
2 protocols using on target plus
Focal Adhesion Kinase Regulation
siRNAs targeting human MLC2 (MYL2; SMART pool, ON-TARGET PLUS, Cat. No.: L-011087000005, siRNAs targeting human FAK (SMART pool, ON-TARGET PLUS, Cat. No.: L-003164000005) were ordered from Dharmacon (Gene Expression and Gene Editing, GE Healthcare, Lafayette, CO, United States). Non-targeting (n.t.) control siRNA (Silencer® Select Negative Control No. 1 siRNA, Cat. No.: 4390843) was purchased from Ambion (Life Technologies, Carlsbad, CA, United States). All siRNAs were re-suspended in RNAse-free water to yield a stock concentration of 20 μM.
Vimentin Overexpression and Knockdown
shLuc: TRCN0000072244, ATCACAGAATCGTCGTATGCA,
shVim #3: TRCN0000029119, GCTAACTACCAAGACACTATT,
shVim #4: TRCN0000029121, GCAGGATGAGATTCAGAATAT.
siRNA were purchased from Thermo (L-003551-00-0005, ON-TARGETplus SMARTpool, Human Vim) combined four siRNA sequences together:
J-003551-06, UCACGAUGACCUUGAAUAA;
J-003551-07, GAGGGAAACUAAUCUGGAU;
J-003551-08, UUAAGACGGUUGAAACUAG;
J-003551-09, GGAAAUGGCUCGUCACCUU.
The primary antibodies used in the study, were as followed: β1-integrin (BD), GAPDH (Santa Cruz), vimentin (Millipore), vinculin (SIGMA), paxillin (BD), E-cadherin (BD), β-catenin (BD), slug (Cell Signaling), filamin A (Cell Signaling), and p-filamin A (Cell Signaling).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!