The largest database of trusted experimental protocols

2 protocols using on target plus

1

Focal Adhesion Kinase Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polyclonal rabbit anti-focal adhesion kinase (FAK) and polyclonal rabbit anti-phospho-Tyr397-FAK were purchased from Cell Signaling (Danvers, MA, United States), polyclonal rabbit anti-MMP1 from Abcam (Cambridge, United Kingdom) and monoclonal anti-β-actin from Sigma (Munich, Germany). Polyclonal rabbit anti-mouse, anti-goat and anti-rabbit IgGs were acquired from Dako (Glostrup, Denmark). Apigenin and luteolin were purchased from Sigma (Munich, Germany) and human recombinant MMP1 from Sigma-Aldrich (SRP3117, St. Louis, MO, United States). U73122 was obtained from Calbiochem (Darmstadt, Germany), BAPTA-AM was from Santa Cruz Biotechnology (Heidelberg, Germany).
siRNAs targeting human MLC2 (MYL2; SMART pool, ON-TARGET PLUS, Cat. No.: L-011087000005, siRNAs targeting human FAK (SMART pool, ON-TARGET PLUS, Cat. No.: L-003164000005) were ordered from Dharmacon (Gene Expression and Gene Editing, GE Healthcare, Lafayette, CO, United States). Non-targeting (n.t.) control siRNA (Silencer® Select Negative Control No. 1 siRNA, Cat. No.: 4390843) was purchased from Ambion (Life Technologies, Carlsbad, CA, United States). All siRNAs were re-suspended in RNAse-free water to yield a stock concentration of 20 μM.
+ Open protocol
+ Expand
2

Vimentin Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
vimentin overexpressed plasmid was purchased from Addgene 31922: pvimentin-PSmOrange with full length of vimentin sequence insertion [56 (link)]. Plasmids of vimentin knockdown were purchased from National RNAi Core Facility Platform in Taiwan:

shLuc: TRCN0000072244, ATCACAGAATCGTCGTATGCA,

shVim #3: TRCN0000029119, GCTAACTACCAAGACACTATT,

shVim #4: TRCN0000029121, GCAGGATGAGATTCAGAATAT.

Cells were transfected by different shVim sequences in a cell population and then selected by Puromycin for two weeks to generate stable clones for further experiment. vimentin overexpressing stable clones were transfected in a cell population and then selected by Neomycin, followed by sorting to purify the vimentin expressing cells.
siRNA were purchased from Thermo (L-003551-00-0005, ON-TARGETplus SMARTpool, Human Vim) combined four siRNA sequences together:

J-003551-06, UCACGAUGACCUUGAAUAA;

J-003551-07, GAGGGAAACUAAUCUGGAU;

J-003551-08, UUAAGACGGUUGAAACUAG;

J-003551-09, GGAAAUGGCUCGUCACCUU.

And the control scramble siRNA sequence was (D-001810-01-05, ON-TARGET plus Non-targeting siRNA #1): UGGUUUACAUGUCGACUAA
The primary antibodies used in the study, were as followed: β1-integrin (BD), GAPDH (Santa Cruz), vimentin (Millipore), vinculin (SIGMA), paxillin (BD), E-cadherin (BD), β-catenin (BD), slug (Cell Signaling), filamin A (Cell Signaling), and p-filamin A (Cell Signaling).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!