The largest database of trusted experimental protocols

Amicon filter tube

Manufactured by Merck Group
Sourced in United States

The Amicon filter tube is a laboratory equipment used for the separation and concentration of macromolecules, such as proteins, nucleic acids, and other biomolecules, from complex solutions. The device utilizes a semi-permeable membrane to selectively allow the passage of smaller molecules while retaining the larger target molecules.

Automatically generated - may contain errors

3 protocols using amicon filter tube

1

Zika and Dengue Virus Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Aedes albopictus C6/36 cells, kindly donated by R. Baric (University of North Carolina at Chapel Hill), were grown to 70% confluence in a 175 cm2 vented tissue culture flask in MEM medium (Life Technologies) supplemented with 10% FBS (Corning), 1% GlutaMAX (Life Technologies), 1% HEPES (Life Technologies), and 1% penicillin/streptomycin (Sciencell). The cells were then infected with unconcentrated ZIKV or DENV1–4 for 5 days. The infectious supernatant was concentrated using a 100-kDa Amicon filter tube (Millipore) and then layered on a discontinuous 20/55% OptiPrep® (Sigma-Aldrich) density gradient and ultracentrifuged at 40,000 RPM at 4 °C for 2 h using a SW41Ti rotor, without brakes. Finally, the purified virus was collected from the interface between 20 and 55% density and was stored at −80 °C.
+ Open protocol
+ Expand
2

Adeno-Associated Virus Variant Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
PAV variants were produced through a triple plasmid cotransfection of (a) pXX6–80, a helper plasmid encoding adenoviral proteins; (b) pscGFP, self-complementary GFP transgene cassette; and (c) packaging plasmids encoding PAV capsid derivatives.17 (link) Wild-type (wt) capsid AAV2 vector was produced through triple transfection of pXX6-80, pscGFP, and pXX2. Human Embryonic Kidney 293T cells (HEK 293T) were split 1:2 and plated on ten 15 cm plates (BD Falcon) coated with 0.001% poly-L-lysine (Sigma) 24h before transfection. Forty-8 h post-transfection, the producer cells were harvested, pelleted, and resuspended in 1× Gradient Buffer (GB: 10 mM Tris, pH 7.6, 10 mM MgCl2, 150 mM NaCl). Cells were then lysed with three freeze–thaw cycles followed by benzonase treatment (50 units/ml, Sigma) at 37 °C for 40 min. Cell lysate was centrifuged at 4 °C at 3,000g for 20 min and the supernatant was collected for iodixanol density gradient separation (Optiprep, Beckman Ultra-Clear QuickSeal Tubes). Samples were centrifuged at 18 °C at 48,000 rpm for 1h 45 min. Viruses were extracted from the 40% iodixanol layer and stored at 4 °C in 3 mL cryovials (Biotix). Viruses were purified with an anion exchange column (Pall Corporation) and concentrated with an amicon filter tube (Millipore) as published elsewhere.17 (link)
+ Open protocol
+ Expand
3

Sec-miR Expression Analysis in Biofluids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA including miRNA was isolated using the miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany) from cell medium, plasma, and urine. Urine samples from each mouse were pooled every week and concentrated with a 100 kDa Amicon filter tube (Millipore, Burlington, MA, USA) down to ~200 µL. RNA was extracted from 200 µL medium or concentrated urine samples and 50 µL plasma samples per prep and eluted with 14 µL nuclease-free water. Next, 5 µL of total RNA was used for RT-PCR with the TaqMan Small RNA assays (Applied Biosystems, Foster City, CA, USA) in 15 µL total reaction mixture. The miRNeasy Serum/Plasma Spike-In Control (cel-miR-39) was used to normalize RNA isolation efficiency. Sec-miR expressions were assessed with the TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) with the custom primer specific for the Sec-miR sequence (AAAUGUACUGCGCGUGGAGAC). Each 20 µL total PCR mixture contained 1.33 µL of the RT product, 1 µL of 20X primer, and 10 µL of TaqMan 2X Universal PCR Master Mix. qRT-PCR was performed on the iCycler Real-Time PCR detection system (Bio-Rad, Hercules, CA USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!