Total RNA was extracted from tissues or cells using TRIzol reagent (Invitrogen). First-strand cDNA synthesis was performed using a High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems). PCR was carried out using the TaqMan Gene Expression Assay (Applied Biosystems) on the ABI7700 Real Time PCR system (Applied Biosystems). The probe/primer sets used are listed in Supplementary Table 2 .
Abi7700 real time pcr system
Manufactured by Thermo Fisher Scientific
The ABI7700 Real Time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of performing precise and accurate measurements of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Hifair 3 one step rt qpcr sybr green kit, by Yeasen (1 mentions)
Uv spectrophotometer, by PerkinElmer (1 mentions)
Sybr premix ex taq reagent, by Takara Bio (1 mentions)
Rna extraction kit, by Omega Bio-Tek (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
3 protocols using abi7700 real time pcr system
1
RNA Extraction and qRT-PCR Analysis
2
RNA Extraction and RT-qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen). The concentration of RNA was tested by spectrophotometry. RT-qPCR were determined using Hifair III One-Step RT-qPCR SYBR Green Kit (Yeasen, Shanghai, China). The reaction condition of RT was 42 °C for 10 min. QPCR was performed on ABI 7700 real-time PCR system (Applied Biosystems) with the following conditions: 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The relative expression (fold change) was calculated using the 2−ΔΔCT method. GAPDH and U6 were the endogenous controls. The specific primer sequences are shown in Table 1 .
Primer sequences for qPCR
| Name | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Circ-FURIN | CGTGCAGACTATGCAAACCAG | TTCTCGGTGCTATAGTGCGT |
| AVEN | GACTTCAGTGTCCTCTTGAG | CCTTGCCATCATCGTTTCTC |
| BCL2 | GGAAGGTAGTGTGTGTGG | ACTCCACTCTCTGGGTTCTTGG |
| XIAP | GACAGTATGCAAGATGAGTCAAGTCA | GCAAAGCTTCTCCTCTTGCAG |
| AREL1 | GAGGGGACCGGACTATTTATGA | TCCTTCCAATCCCAGGAGACT |
| miR-195-5p | CGCAGCACAGAAATATTGGC | CTCAACTGGTGTCGTGGAGTC |
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
| U6 | GCTTCGGCAGCACATATACTAAAAT | GCTTCGGCAGCACATATACTAAAAT |
3
Quantitative RT-PCR Analysis of EBV Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and purified and used to synthesize cDNA. An RNA extraction kit (Omega Bio-Tek Inc., Doraville, GA, uSA) was used to extract total RNA from induced tumor tissues and matched lymphocytes from 'normal' donors, with B 95-8 cells as a positive control (B 95-8 cells were derived from marmoset leukocytes transformed by EBV). The quality and quantity of the RNA samples were determined using a uV spectrophotometer (Perkin-Elmer, Fremont, CA, USA), followed by storage at -80˚C. In accordance with the instructions of the reverse transcription kit (Promega Corporation, Madison, WI, USA), 2 µg RNA from each sample was used for cDNA synthesis. mRNA expression was detected by qRT-PCR using SYBR Premix Ex Taq reagent (Takara, Dalian, China). qRT-PCR was carried out in a 96-well plate using an ABI 7700 Real-Time PCR system (Applied Biosystems, Foster City, CA, uSA). The primers used are listed in Table I.
RNA from B 95-8 cells was used as a template to obtain cDNA for qRT-PCR. A standard curve was established based on the initial cDNA duplication number and CT value for real-time fluorescent quantitative detection of B 95-8 cells. The template content in the sample was determined by relative quantitation using the ΔΔCT method, standardized by the duplication number of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. Each sample was tested in triplicate.
RNA from B 95-8 cells was used as a template to obtain cDNA for qRT-PCR. A standard curve was established based on the initial cDNA duplication number and CT value for real-time fluorescent quantitative detection of B 95-8 cells. The template content in the sample was determined by relative quantitation using the ΔΔCT method, standardized by the duplication number of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. Each sample was tested in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!